ID: 1039140322

View in Genome Browser
Species Human (GRCh38)
Location 8:34380307-34380329
Sequence GGTCAGCGTGGGTTAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039140317_1039140322 16 Left 1039140317 8:34380268-34380290 CCTGGAGAAGTGGTATCAAAAGA No data
Right 1039140322 8:34380307-34380329 GGTCAGCGTGGGTTAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039140322 Original CRISPR GGTCAGCGTGGGTTAGGAAA AGG Intergenic
No off target data available for this crispr