ID: 1039143875

View in Genome Browser
Species Human (GRCh38)
Location 8:34423416-34423438
Sequence CTTATGTGGGCCATTATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039143875_1039143879 16 Left 1039143875 8:34423416-34423438 CCTTTGATAATGGCCCACATAAG No data
Right 1039143879 8:34423455-34423477 GCACAAAGTACACTGTAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039143875 Original CRISPR CTTATGTGGGCCATTATCAA AGG (reversed) Intergenic
No off target data available for this crispr