ID: 1039153736

View in Genome Browser
Species Human (GRCh38)
Location 8:34532121-34532143
Sequence GACCAATGGCATAGATGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039153734_1039153736 -2 Left 1039153734 8:34532100-34532122 CCTTGAGACAGAAATGTGTATGA No data
Right 1039153736 8:34532121-34532143 GACCAATGGCATAGATGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039153736 Original CRISPR GACCAATGGCATAGATGTGT TGG Intergenic
No off target data available for this crispr