ID: 1039155276

View in Genome Browser
Species Human (GRCh38)
Location 8:34548698-34548720
Sequence TTAGTTGACCACATATATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039155275_1039155276 10 Left 1039155275 8:34548665-34548687 CCTAGTATGTATTCTTGACACTC No data
Right 1039155276 8:34548698-34548720 TTAGTTGACCACATATATATTGG No data
1039155274_1039155276 17 Left 1039155274 8:34548658-34548680 CCTTTTTCCTAGTATGTATTCTT No data
Right 1039155276 8:34548698-34548720 TTAGTTGACCACATATATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039155276 Original CRISPR TTAGTTGACCACATATATAT TGG Intergenic
No off target data available for this crispr