ID: 1039158114

View in Genome Browser
Species Human (GRCh38)
Location 8:34585960-34585982
Sequence TGCTTCATTCAGATAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039158109_1039158114 27 Left 1039158109 8:34585910-34585932 CCACCTCTGATTCTCATGGTGTT No data
Right 1039158114 8:34585960-34585982 TGCTTCATTCAGATAGAACATGG No data
1039158110_1039158114 24 Left 1039158110 8:34585913-34585935 CCTCTGATTCTCATGGTGTTATG No data
Right 1039158114 8:34585960-34585982 TGCTTCATTCAGATAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039158114 Original CRISPR TGCTTCATTCAGATAGAACA TGG Intergenic
No off target data available for this crispr