ID: 1039162151

View in Genome Browser
Species Human (GRCh38)
Location 8:34634264-34634286
Sequence AACACAGATGTCCCTACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039162145_1039162151 24 Left 1039162145 8:34634217-34634239 CCTTCCCTACCTGCTTATTCTCA No data
Right 1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG No data
1039162148_1039162151 15 Left 1039162148 8:34634226-34634248 CCTGCTTATTCTCACTGTCATTT No data
Right 1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG No data
1039162146_1039162151 20 Left 1039162146 8:34634221-34634243 CCCTACCTGCTTATTCTCACTGT No data
Right 1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG No data
1039162149_1039162151 -10 Left 1039162149 8:34634251-34634273 CCCTGATTAGTAAAACACAGATG No data
Right 1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG No data
1039162147_1039162151 19 Left 1039162147 8:34634222-34634244 CCTACCTGCTTATTCTCACTGTC No data
Right 1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039162151 Original CRISPR AACACAGATGTCCCTACAAC AGG Intergenic
No off target data available for this crispr