ID: 1039172849

View in Genome Browser
Species Human (GRCh38)
Location 8:34768055-34768077
Sequence GCCATATTTGACCATAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039172849_1039172851 -3 Left 1039172849 8:34768055-34768077 CCTACTTTATGGTCAAATATGGC No data
Right 1039172851 8:34768075-34768097 GGCTGTACAAATACAATTCTGGG No data
1039172849_1039172852 7 Left 1039172849 8:34768055-34768077 CCTACTTTATGGTCAAATATGGC No data
Right 1039172852 8:34768085-34768107 ATACAATTCTGGGCTTTAAGTGG No data
1039172849_1039172850 -4 Left 1039172849 8:34768055-34768077 CCTACTTTATGGTCAAATATGGC No data
Right 1039172850 8:34768074-34768096 TGGCTGTACAAATACAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039172849 Original CRISPR GCCATATTTGACCATAAAGT AGG (reversed) Intergenic
No off target data available for this crispr