ID: 1039172852

View in Genome Browser
Species Human (GRCh38)
Location 8:34768085-34768107
Sequence ATACAATTCTGGGCTTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039172846_1039172852 30 Left 1039172846 8:34768032-34768054 CCATTCTTAATCAGCTGAATGAA No data
Right 1039172852 8:34768085-34768107 ATACAATTCTGGGCTTTAAGTGG No data
1039172849_1039172852 7 Left 1039172849 8:34768055-34768077 CCTACTTTATGGTCAAATATGGC No data
Right 1039172852 8:34768085-34768107 ATACAATTCTGGGCTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039172852 Original CRISPR ATACAATTCTGGGCTTTAAG TGG Intergenic
No off target data available for this crispr