ID: 1039175203

View in Genome Browser
Species Human (GRCh38)
Location 8:34796223-34796245
Sequence TACAGTATTTTGAGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039175202_1039175203 0 Left 1039175202 8:34796200-34796222 CCTCAGCTGTGATCTGAAAACAT No data
Right 1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG No data
1039175201_1039175203 1 Left 1039175201 8:34796199-34796221 CCCTCAGCTGTGATCTGAAAACA No data
Right 1039175203 8:34796223-34796245 TACAGTATTTTGAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039175203 Original CRISPR TACAGTATTTTGAGAGAAAG AGG Intergenic
No off target data available for this crispr