ID: 1039176273

View in Genome Browser
Species Human (GRCh38)
Location 8:34810370-34810392
Sequence CAGCAGAAAGAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039176269_1039176273 12 Left 1039176269 8:34810335-34810357 CCAGAGAAGCACTTGCAGTGGAG No data
Right 1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039176273 Original CRISPR CAGCAGAAAGAGATGGAGGC TGG Intergenic
No off target data available for this crispr