ID: 1039176873

View in Genome Browser
Species Human (GRCh38)
Location 8:34818342-34818364
Sequence ACATTGCCTCAGAGAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039176873_1039176875 -10 Left 1039176873 8:34818342-34818364 CCAAGCTCTCTCTGAGGCAATGT No data
Right 1039176875 8:34818355-34818377 GAGGCAATGTGGTTTTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039176873 Original CRISPR ACATTGCCTCAGAGAGAGCT TGG (reversed) Intergenic
No off target data available for this crispr