ID: 1039179536

View in Genome Browser
Species Human (GRCh38)
Location 8:34849983-34850005
Sequence GTGCCCTCTGGTCAGTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039179536_1039179541 5 Left 1039179536 8:34849983-34850005 CCAATAAACTGACCAGAGGGCAC No data
Right 1039179541 8:34850011-34850033 TGAAGTTACCTCAGGAAAGGAGG No data
1039179536_1039179540 2 Left 1039179536 8:34849983-34850005 CCAATAAACTGACCAGAGGGCAC No data
Right 1039179540 8:34850008-34850030 AGGTGAAGTTACCTCAGGAAAGG No data
1039179536_1039179539 -3 Left 1039179536 8:34849983-34850005 CCAATAAACTGACCAGAGGGCAC No data
Right 1039179539 8:34850003-34850025 CACTCAGGTGAAGTTACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039179536 Original CRISPR GTGCCCTCTGGTCAGTTTAT TGG (reversed) Intergenic
No off target data available for this crispr