ID: 1039180839

View in Genome Browser
Species Human (GRCh38)
Location 8:34864279-34864301
Sequence GGGTGTTCCCAGAACTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039180833_1039180839 0 Left 1039180833 8:34864256-34864278 CCACCCATTTTTACACCAAATAT 0: 27
1: 40
2: 52
3: 105
4: 880
Right 1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG No data
1039180835_1039180839 -3 Left 1039180835 8:34864259-34864281 CCCATTTTTACACCAAATATGGG No data
Right 1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG No data
1039180837_1039180839 -4 Left 1039180837 8:34864260-34864282 CCATTTTTACACCAAATATGGGT No data
Right 1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039180839 Original CRISPR GGGTGTTCCCAGAACTGTCA TGG Intergenic
No off target data available for this crispr