ID: 1039182044

View in Genome Browser
Species Human (GRCh38)
Location 8:34877970-34877992
Sequence CAGAGTGAAGTGAAGATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039182044_1039182049 8 Left 1039182044 8:34877970-34877992 CCCATTATCTTCACTTCACTCTG No data
Right 1039182049 8:34878001-34878023 GCTTTTCCTTCCCTTCGCAGGGG No data
1039182044_1039182047 6 Left 1039182044 8:34877970-34877992 CCCATTATCTTCACTTCACTCTG No data
Right 1039182047 8:34877999-34878021 TGGCTTTTCCTTCCCTTCGCAGG No data
1039182044_1039182048 7 Left 1039182044 8:34877970-34877992 CCCATTATCTTCACTTCACTCTG No data
Right 1039182048 8:34878000-34878022 GGCTTTTCCTTCCCTTCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039182044 Original CRISPR CAGAGTGAAGTGAAGATAAT GGG (reversed) Intergenic
No off target data available for this crispr