ID: 1039183774

View in Genome Browser
Species Human (GRCh38)
Location 8:34894178-34894200
Sequence TGGGACTCCTTGGAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039183767_1039183774 0 Left 1039183767 8:34894155-34894177 CCCTAAGATAACTTCTGGTACCC No data
Right 1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG No data
1039183764_1039183774 25 Left 1039183764 8:34894130-34894152 CCACTCTTAATGCAAGCATGAGA No data
Right 1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG No data
1039183768_1039183774 -1 Left 1039183768 8:34894156-34894178 CCTAAGATAACTTCTGGTACCCT No data
Right 1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039183774 Original CRISPR TGGGACTCCTTGGAAAAAAC AGG Intergenic
No off target data available for this crispr