ID: 1039185103

View in Genome Browser
Species Human (GRCh38)
Location 8:34907885-34907907
Sequence AGTGGGGCATGAAATTTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039185103_1039185107 7 Left 1039185103 8:34907885-34907907 CCAGTAAAATTTCATGCCCCACT No data
Right 1039185107 8:34907915-34907937 TTTCTTTTGCTTTTAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039185103 Original CRISPR AGTGGGGCATGAAATTTTAC TGG (reversed) Intergenic
No off target data available for this crispr