ID: 1039190398

View in Genome Browser
Species Human (GRCh38)
Location 8:34967162-34967184
Sequence AACTGTGTCCTGCAATATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039190398_1039190399 9 Left 1039190398 8:34967162-34967184 CCAAGATATTGCAGGACACAGTT No data
Right 1039190399 8:34967194-34967216 GTTTTGCCCTTACAATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039190398 Original CRISPR AACTGTGTCCTGCAATATCT TGG (reversed) Intergenic
No off target data available for this crispr