ID: 1039193274

View in Genome Browser
Species Human (GRCh38)
Location 8:35001478-35001500
Sequence GCATGTATTAAGTTCAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039193274_1039193276 -5 Left 1039193274 8:35001478-35001500 CCATTTTTGAACTTAATACATGC No data
Right 1039193276 8:35001496-35001518 CATGCTGAAATGTGAGTTCTGGG No data
1039193274_1039193275 -6 Left 1039193274 8:35001478-35001500 CCATTTTTGAACTTAATACATGC No data
Right 1039193275 8:35001495-35001517 ACATGCTGAAATGTGAGTTCTGG No data
1039193274_1039193277 7 Left 1039193274 8:35001478-35001500 CCATTTTTGAACTTAATACATGC No data
Right 1039193277 8:35001508-35001530 TGAGTTCTGGGCATTTCCCCTGG No data
1039193274_1039193278 15 Left 1039193274 8:35001478-35001500 CCATTTTTGAACTTAATACATGC No data
Right 1039193278 8:35001516-35001538 GGGCATTTCCCCTGGATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039193274 Original CRISPR GCATGTATTAAGTTCAAAAA TGG (reversed) Intergenic
No off target data available for this crispr