ID: 1039194838

View in Genome Browser
Species Human (GRCh38)
Location 8:35019608-35019630
Sequence CTAAGCTGCAGATGCTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039194836_1039194838 10 Left 1039194836 8:35019575-35019597 CCAGGAACTGTGTCAGGGATGTC No data
Right 1039194838 8:35019608-35019630 CTAAGCTGCAGATGCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039194838 Original CRISPR CTAAGCTGCAGATGCTAACA AGG Intergenic
No off target data available for this crispr