ID: 1039196361

View in Genome Browser
Species Human (GRCh38)
Location 8:35035901-35035923
Sequence CAAGACCACCTGAAGTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039196359_1039196361 2 Left 1039196359 8:35035876-35035898 CCTGAGGTGAATGTTTCTCTGCT No data
Right 1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG No data
1039196358_1039196361 12 Left 1039196358 8:35035866-35035888 CCTATTTGTTCCTGAGGTGAATG No data
Right 1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039196361 Original CRISPR CAAGACCACCTGAAGTTTTC AGG Intergenic
No off target data available for this crispr