ID: 1039198792

View in Genome Browser
Species Human (GRCh38)
Location 8:35063005-35063027
Sequence TTTGGGGGCTTCAAGTTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039198792_1039198797 8 Left 1039198792 8:35063005-35063027 CCACGAAACTTGAAGCCCCCAAA No data
Right 1039198797 8:35063036-35063058 ACCCAAAGACATTTTCACCAAGG No data
1039198792_1039198800 12 Left 1039198792 8:35063005-35063027 CCACGAAACTTGAAGCCCCCAAA No data
Right 1039198800 8:35063040-35063062 AAAGACATTTTCACCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039198792 Original CRISPR TTTGGGGGCTTCAAGTTTCG TGG (reversed) Intergenic
No off target data available for this crispr