ID: 1039198797

View in Genome Browser
Species Human (GRCh38)
Location 8:35063036-35063058
Sequence ACCCAAAGACATTTTCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039198794_1039198797 -8 Left 1039198794 8:35063021-35063043 CCCCAAAAAGATACAACCCAAAG No data
Right 1039198797 8:35063036-35063058 ACCCAAAGACATTTTCACCAAGG No data
1039198792_1039198797 8 Left 1039198792 8:35063005-35063027 CCACGAAACTTGAAGCCCCCAAA No data
Right 1039198797 8:35063036-35063058 ACCCAAAGACATTTTCACCAAGG No data
1039198793_1039198797 -7 Left 1039198793 8:35063020-35063042 CCCCCAAAAAGATACAACCCAAA No data
Right 1039198797 8:35063036-35063058 ACCCAAAGACATTTTCACCAAGG No data
1039198795_1039198797 -9 Left 1039198795 8:35063022-35063044 CCCAAAAAGATACAACCCAAAGA No data
Right 1039198797 8:35063036-35063058 ACCCAAAGACATTTTCACCAAGG No data
1039198796_1039198797 -10 Left 1039198796 8:35063023-35063045 CCAAAAAGATACAACCCAAAGAC No data
Right 1039198797 8:35063036-35063058 ACCCAAAGACATTTTCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039198797 Original CRISPR ACCCAAAGACATTTTCACCA AGG Intergenic
No off target data available for this crispr