ID: 1039202916

View in Genome Browser
Species Human (GRCh38)
Location 8:35116594-35116616
Sequence GAGGGCTACTAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039202916_1039202922 11 Left 1039202916 8:35116594-35116616 CCCTCTGCCCTCTAGTAGCCCTC No data
Right 1039202922 8:35116628-35116650 CTCCCATCTTTATGTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039202916 Original CRISPR GAGGGCTACTAGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr