ID: 1039203320

View in Genome Browser
Species Human (GRCh38)
Location 8:35121010-35121032
Sequence CACTCATCAGTTATGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039203317_1039203320 0 Left 1039203317 8:35120987-35121009 CCATTCCATAGCATTAGGATCAT No data
Right 1039203320 8:35121010-35121032 CACTCATCAGTTATGGTACATGG No data
1039203315_1039203320 7 Left 1039203315 8:35120980-35121002 CCTGTGGCCATTCCATAGCATTA No data
Right 1039203320 8:35121010-35121032 CACTCATCAGTTATGGTACATGG No data
1039203318_1039203320 -5 Left 1039203318 8:35120992-35121014 CCATAGCATTAGGATCATCACTC No data
Right 1039203320 8:35121010-35121032 CACTCATCAGTTATGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039203320 Original CRISPR CACTCATCAGTTATGGTACA TGG Intergenic
No off target data available for this crispr