ID: 1039210264

View in Genome Browser
Species Human (GRCh38)
Location 8:35205080-35205102
Sequence GGCTGAACACTCCCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039210264_1039210269 5 Left 1039210264 8:35205080-35205102 CCAGCTCCTGGGAGTGTTCAGCC No data
Right 1039210269 8:35205108-35205130 TGTGCCTCCCCTGCAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039210264 Original CRISPR GGCTGAACACTCCCAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr