ID: 1039211605

View in Genome Browser
Species Human (GRCh38)
Location 8:35222202-35222224
Sequence AGGGAGAGCACAGTGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039211605_1039211612 12 Left 1039211605 8:35222202-35222224 CCTTTATTCACTGTGCTCTCCCT No data
Right 1039211612 8:35222237-35222259 TAGGCTCACTTTTAACCCCATGG No data
1039211605_1039211613 13 Left 1039211605 8:35222202-35222224 CCTTTATTCACTGTGCTCTCCCT No data
Right 1039211613 8:35222238-35222260 AGGCTCACTTTTAACCCCATGGG No data
1039211605_1039211607 -7 Left 1039211605 8:35222202-35222224 CCTTTATTCACTGTGCTCTCCCT No data
Right 1039211607 8:35222218-35222240 TCTCCCTCATCCCTAATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039211605 Original CRISPR AGGGAGAGCACAGTGAATAA AGG (reversed) Intergenic
No off target data available for this crispr