ID: 1039211607

View in Genome Browser
Species Human (GRCh38)
Location 8:35222218-35222240
Sequence TCTCCCTCATCCCTAATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039211603_1039211607 16 Left 1039211603 8:35222179-35222201 CCACAAAATTCTCCTATTTGCTT No data
Right 1039211607 8:35222218-35222240 TCTCCCTCATCCCTAATGGTAGG No data
1039211604_1039211607 4 Left 1039211604 8:35222191-35222213 CCTATTTGCTTCCTTTATTCACT No data
Right 1039211607 8:35222218-35222240 TCTCCCTCATCCCTAATGGTAGG No data
1039211602_1039211607 23 Left 1039211602 8:35222172-35222194 CCAGCAGCCACAAAATTCTCCTA No data
Right 1039211607 8:35222218-35222240 TCTCCCTCATCCCTAATGGTAGG No data
1039211605_1039211607 -7 Left 1039211605 8:35222202-35222224 CCTTTATTCACTGTGCTCTCCCT No data
Right 1039211607 8:35222218-35222240 TCTCCCTCATCCCTAATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039211607 Original CRISPR TCTCCCTCATCCCTAATGGT AGG Intergenic
No off target data available for this crispr