ID: 1039211613

View in Genome Browser
Species Human (GRCh38)
Location 8:35222238-35222260
Sequence AGGCTCACTTTTAACCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039211609_1039211613 -7 Left 1039211609 8:35222222-35222244 CCTCATCCCTAATGGTAGGCTCA No data
Right 1039211613 8:35222238-35222260 AGGCTCACTTTTAACCCCATGGG No data
1039211605_1039211613 13 Left 1039211605 8:35222202-35222224 CCTTTATTCACTGTGCTCTCCCT No data
Right 1039211613 8:35222238-35222260 AGGCTCACTTTTAACCCCATGGG No data
1039211608_1039211613 -6 Left 1039211608 8:35222221-35222243 CCCTCATCCCTAATGGTAGGCTC No data
Right 1039211613 8:35222238-35222260 AGGCTCACTTTTAACCCCATGGG No data
1039211604_1039211613 24 Left 1039211604 8:35222191-35222213 CCTATTTGCTTCCTTTATTCACT No data
Right 1039211613 8:35222238-35222260 AGGCTCACTTTTAACCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039211613 Original CRISPR AGGCTCACTTTTAACCCCAT GGG Intergenic
No off target data available for this crispr