ID: 1039212818

View in Genome Browser
Species Human (GRCh38)
Location 8:35235802-35235824
Sequence CACCGCAGGCGGCGGCGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039212805_1039212818 13 Left 1039212805 8:35235766-35235788 CCGGAACGCGGCGAGGAGCATGG 0: 1
1: 0
2: 0
3: 4
4: 191
Right 1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG 0: 1
1: 1
2: 1
3: 23
4: 254
1039212803_1039212818 17 Left 1039212803 8:35235762-35235784 CCCTCCGGAACGCGGCGAGGAGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG 0: 1
1: 1
2: 1
3: 23
4: 254
1039212801_1039212818 20 Left 1039212801 8:35235759-35235781 CCGCCCTCCGGAACGCGGCGAGG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG 0: 1
1: 1
2: 1
3: 23
4: 254
1039212804_1039212818 16 Left 1039212804 8:35235763-35235785 CCTCCGGAACGCGGCGAGGAGCA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG 0: 1
1: 1
2: 1
3: 23
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039212818 Original CRISPR CACCGCAGGCGGCGGCGGAG GGG Exonic
900096471 1:942051-942073 TAGCGGAGGCGGCGGGGGAGGGG + Intronic
901551330 1:9997770-9997792 CACGGAAGGCGGCTGCGGGGAGG - Intronic
902338465 1:15767442-15767464 CACTGGAGGGGGCGGTGGAGGGG - Exonic
904618194 1:31761028-31761050 CCGCGCGGGCGGCGGGGGAGGGG + Intronic
904751124 1:32741935-32741957 CATGGCAGGCGGGGGCGGAGCGG - Exonic
904814088 1:33182120-33182142 CCCCGCAGCGGGCGGGGGAGGGG + Intergenic
905449004 1:38045433-38045455 CGCCGCCGGCGGGGGCGGTGGGG + Exonic
905580729 1:39081482-39081504 CAGCGAAGGCGGCGGCGGCCGGG - Intronic
906197260 1:43936732-43936754 AGCCGCAGGCGGTGGCGGAGAGG - Exonic
906214294 1:44030305-44030327 CACCGCAGGGGCCGGGGGCGGGG - Intronic
907091611 1:51730105-51730127 CACCCCAGGGGGCGGCGGGAAGG - Intronic
909001364 1:70221450-70221472 CGCCGCACGCCGCGGGGGAGGGG - Intronic
912514717 1:110210581-110210603 TACCGGGGGCGGCGGCCGAGCGG - Intergenic
912798562 1:112707081-112707103 CGCAGCTGGAGGCGGCGGAGCGG - Exonic
915322426 1:155063108-155063130 CTCAGGTGGCGGCGGCGGAGGGG - Intergenic
915463191 1:156081738-156081760 CGCCGCGGGCGGCGGCGGCGGGG + Exonic
915511370 1:156388654-156388676 AAGCCCAGGCGGCGGCGAAGGGG - Intergenic
916666929 1:166975347-166975369 GGCAGCGGGCGGCGGCGGAGCGG + Intronic
922526674 1:226309346-226309368 GGCCGGAGGCGGCGGCGGAGGGG - Exonic
922802746 1:228371697-228371719 CACCGCAGGCCTCCGAGGAGGGG - Exonic
922958590 1:229625911-229625933 TCCCGGAGGCGGCGGCGGCGGGG - Exonic
1065099929 10:22321966-22321988 CCCTGCTGGCGGCGGCGGCGCGG - Intronic
1065589784 10:27252573-27252595 CGCCCCTGGCGGCGGCGGCGGGG - Intergenic
1066004463 10:31133971-31133993 CTCCTCAGGCTGCGGGGGAGGGG - Intergenic
1067113954 10:43420561-43420583 CAGCGCTGCCGGCGGCGGGGCGG + Intergenic
1067140023 10:43648854-43648876 CAGCGCCGGCGCCGGCGGAATGG + Intronic
1069837628 10:71319275-71319297 CGCCGGAGGCAGCGGCGGCGTGG + Exonic
1070263712 10:74882065-74882087 CACCTCAGGTGGAGGCGCAGCGG - Intronic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070768619 10:79070061-79070083 CACCGCCGCCGGAGACGGAGAGG - Intronic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1071966592 10:90858108-90858130 GGCCGGAGGCGGCGGCGGCGGGG - Intergenic
1075768780 10:124916672-124916694 GACCGCAGTCGGCCGCGGAAAGG + Intergenic
1076020207 10:127066212-127066234 CACCGCAGCTGGGGGCGGCGGGG - Intronic
1077184423 11:1229916-1229938 CACCGCAGGCGGAGGCTGGTGGG - Intronic
1079630363 11:22666994-22667016 CACCCGGGGCGGCGGGGGAGGGG + Intronic
1081807900 11:45900158-45900180 CTCTGCGGGCGGCGGCGGCGCGG + Exonic
1083899805 11:65638146-65638168 CAGCGCGGGCGGCGGCGGCTGGG + Intronic
1084264497 11:67997873-67997895 CCACGCAGGCCGCGGAGGAGCGG + Intronic
1084284177 11:68120983-68121005 CAGCGGCAGCGGCGGCGGAGGGG + Exonic
1084674852 11:70628369-70628391 CACCAAAGTCGGGGGCGGAGAGG + Intronic
1084755638 11:71236927-71236949 CACTGCAGGCAGCGGCCGGGAGG + Intronic
1085312700 11:75525694-75525716 CAGGGCAGGCGCCGGCGGGGAGG + Exonic
1087505907 11:99020836-99020858 CAGCGCGGGCGGCCGGGGAGGGG + Intergenic
1089165809 11:116475597-116475619 CACGGCAGGGGGCGGGGGAGGGG + Intergenic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1089713767 11:120336633-120336655 AGCCGCTGGCGCCGGCGGAGAGG - Intergenic
1091587871 12:1826591-1826613 CCCCGCAGGCGTTGGCAGAGGGG - Intronic
1093450302 12:19306378-19306400 CACTGCACGCCGCGGGGGAGGGG - Intronic
1093685068 12:22046161-22046183 CACCGCGAGGGGCGGGGGAGGGG + Exonic
1094536563 12:31326435-31326457 GGCTGCAGGCCGCGGCGGAGAGG + Intronic
1096121607 12:49092466-49092488 CACCGCGGGAGGAGGCGCAGAGG + Intronic
1096774811 12:53957345-53957367 CACCGCAGGCAACGGAGGAGTGG - Exonic
1097107700 12:56635034-56635056 CTGGGCCGGCGGCGGCGGAGGGG + Intronic
1101409516 12:104457134-104457156 GATCGGAGGAGGCGGCGGAGCGG + Exonic
1103488164 12:121296645-121296667 CGCGGGAGGCGGCGGCGGCGCGG - Intronic
1103856088 12:123972460-123972482 CAGCGCCGGCGGGGGCGGAGGGG - Intronic
1104070945 12:125344915-125344937 CATCTCTGGCGGCGGCGGAATGG - Intronic
1104990083 12:132619870-132619892 CCACGCAGTCGGCGTCGGAGAGG - Exonic
1105011893 12:132761766-132761788 CGCGGCTGGCGGCGGCCGAGTGG - Exonic
1106227744 13:27797570-27797592 CAACCCAGGCGGCAGAGGAGAGG - Intergenic
1107951353 13:45465062-45465084 TGCCTGAGGCGGCGGCGGAGCGG + Exonic
1112290895 13:98143363-98143385 ACCCGCGGGCGGCGGCGGCGCGG - Intronic
1112328582 13:98460159-98460181 CATTCCAGGCTGCGGCGGAGTGG + Intronic
1114265700 14:21071401-21071423 CACCGCAGGGAGTGGAGGAGGGG + Intronic
1114270672 14:21098317-21098339 CCGGGCGGGCGGCGGCGGAGCGG + Exonic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1121342792 14:93115406-93115428 GCCCGCAGGCGGCGGGGGCGTGG - Intronic
1121417509 14:93789097-93789119 CGGCGCTGGCGGCGGCGGCGGGG - Intergenic
1121595278 14:95157430-95157452 CTCCGCAGGCGCCGGCGGGAGGG - Intronic
1122349124 14:101077581-101077603 CCCGGCAGGCGGGGGCGGAGTGG + Intergenic
1123024925 14:105420011-105420033 CCGGGCCGGCGGCGGCGGAGGGG - Exonic
1123495247 15:20817128-20817150 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1123551736 15:21386221-21386243 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1124952696 15:34338028-34338050 CACCGCGGGCTGCGGCGGCTGGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132055632 15:98648839-98648861 CAGAGCAGGCGGCGGCGGGCGGG + Intergenic
1202960081 15_KI270727v1_random:113463-113485 AGCCGCAGGCTGTGGCGGAGGGG + Intergenic
1133259428 16:4538564-4538586 CGCCGCGGGCGGGGGCGGGGAGG + Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1135517669 16:23149156-23149178 CCGCGCTGGCGGCGGCGGCGCGG - Exonic
1137288781 16:47037748-47037770 CTCCGGAGGCGGCGGCTGGGAGG + Intergenic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1139546627 16:67652855-67652877 CAGCGGCGGCGGCGGGGGAGGGG + Intronic
1141169610 16:81682905-81682927 CACCGCATGAGGCGCAGGAGGGG + Intronic
1141497231 16:84418646-84418668 CACGGCAGTGGGCGGTGGAGGGG + Intronic
1141688311 16:85582628-85582650 CACCCCAGGCGGCTGCGTAAGGG - Intergenic
1142029935 16:87833408-87833430 CACAGCAGGCAGGGCCGGAGGGG + Intronic
1142174361 16:88638436-88638458 CACAGCAGGCGGGGGCTGCGGGG + Intergenic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1142770638 17:2094288-2094310 CACCCCAGGCTGCGGTGCAGTGG + Intronic
1143196225 17:5078306-5078328 CTCGGCAGGCGGCGGCGACGTGG + Exonic
1143560015 17:7688181-7688203 CTCTGCAGGCGGCGGGGGGGCGG + Exonic
1144953200 17:19004807-19004829 GACCGCAGGTGGCGGCGGCGGGG - Intronic
1146747518 17:35345625-35345647 AGCAGCAGGCGGCTGCGGAGGGG - Intergenic
1148268239 17:46243605-46243627 CTCTGCGGGCGGCGGCGGCGCGG + Intergenic
1148556597 17:48582230-48582252 CACCGGCGGCGGCGGCGCGGAGG + Intronic
1148558375 17:48592118-48592140 CCCAGCGGGCGGCGGCAGAGCGG + Exonic
1148852253 17:50560969-50560991 CGCGCCAGGCGGCGGGGGAGGGG - Intergenic
1151477825 17:74353845-74353867 GAGCGGAGGCGGCGGGGGAGGGG - Intronic
1151783767 17:76265358-76265380 CCGGGCGGGCGGCGGCGGAGCGG + Exonic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1154218213 18:12431343-12431365 CCACGCAGACGGCGGCGGTGGGG - Exonic
1154416343 18:14177907-14177929 CACTGCCGGCGGCGCCGGGGTGG + Intergenic
1156502361 18:37567574-37567596 CCCCGCAGCCCGCGGGGGAGCGG - Intergenic
1157545031 18:48540744-48540766 GACCGCAGACCGCGGCGTAGTGG + Intronic
1158953878 18:62522645-62522667 CACCACTGGCGGAGGCGGGGCGG + Intergenic
1159798107 18:72867788-72867810 CGGCGCCGGCGGCGGCGGGGTGG + Exonic
1160967877 19:1754466-1754488 CGGCACAGGCAGCGGCGGAGCGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162731421 19:12721215-12721237 GGCCACAGGCGGCGGCGGCGGGG + Intronic
1163138826 19:15332570-15332592 CACACCGGGCGGCGGCGGCGCGG - Intergenic
1163577163 19:18117791-18117813 GACCGCGGGCGGCGGGGGCGGGG - Intronic
1163632624 19:18425083-18425105 GACAGCAGGAGGGGGCGGAGAGG + Intronic
1165158151 19:33800461-33800483 CACCGCAAGGAGCGGCCGAGCGG + Exonic
1165459535 19:35936512-35936534 CAGCGCAGGCGGGGGCGCAGGGG - Intronic
1166329280 19:42069357-42069379 CACCACCGGCGGCGGGGGAGGGG - Intronic
1166361672 19:42255130-42255152 CCCGGGAGGCGGCGGCGGGGAGG - Exonic
1167072915 19:47230945-47230967 CGCCGGAGGGGGCGGCGGTGGGG + Intronic
1167379948 19:49132993-49133015 CTCCGCAGGCGCTGGCGCAGCGG + Exonic
1167638634 19:50668528-50668550 CACGGCGGGCGGCGGCTGCGGGG + Exonic
1168076353 19:53982609-53982631 CGGCGGAGGCGGCGGCGGGGCGG + Exonic
926107584 2:10162087-10162109 CATCCCAGGCAGCGGCGGATGGG - Intronic
929242373 2:39665946-39665968 CACCGGCGGCTGCGGCGGGGCGG + Exonic
932042963 2:68319444-68319466 CAGCGCCGGCTGCGGCCGAGTGG + Exonic
936556778 2:113503432-113503454 CACCGGGGGCGGTGGCGCAGAGG - Intergenic
936985722 2:118310174-118310196 CATCGCGGGCGGCGGCCGCGCGG - Intergenic
939969668 2:148644974-148644996 CAGCCCGGGCGGCGGCGGCGGGG - Exonic
941987486 2:171522988-171523010 CGCTGCTGGGGGCGGCGGAGCGG + Intronic
942840916 2:180359897-180359919 CACAGCAGGTGGCGGCTGAGTGG + Intergenic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
947592933 2:231395585-231395607 CCCGCCAGGCGGCGGCGGGGCGG + Exonic
947715236 2:232335916-232335938 CACCGCAGGAGGCAGGAGAGGGG - Intronic
947860497 2:233354477-233354499 CACCGCGGGCGGGGGCGGGGCGG - Intergenic
948624775 2:239262098-239262120 CACTGCAGGCGGCGCTGGCGTGG - Intronic
948824651 2:240568408-240568430 CGCCCCCGGCGGCGGCCGAGCGG + Intronic
948953761 2:241272239-241272261 CCCCCCAGGTGGCGGCGGGGCGG - Intronic
949051933 2:241902325-241902347 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051940 2:241902342-241902364 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051947 2:241902359-241902381 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051954 2:241902376-241902398 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051961 2:241902393-241902415 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051968 2:241902410-241902432 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949075363 2:242054338-242054360 CACCTCAGGCAGGGGTGGAGGGG + Intergenic
1168800511 20:641700-641722 CACTGCAGACGGCGGCGCTGAGG + Intergenic
1169224292 20:3846738-3846760 CGACGCAGGCGGCTGCGCAGCGG - Intergenic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172703000 20:36863911-36863933 CAGGGGAGGAGGCGGCGGAGCGG - Intergenic
1172843329 20:37915145-37915167 CCCGGCAGGCAGCGGAGGAGAGG + Intronic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1175840203 20:62021867-62021889 CACCTCAGACGGCGACAGAGAGG + Intronic
1175924585 20:62465584-62465606 CACCGCAGGCGTGGGTGGTGTGG + Intronic
1176038052 20:63049913-63049935 CAGCGCAGGCCAGGGCGGAGGGG - Intergenic
1176117682 20:63440155-63440177 CACCACAAGAGGCGGGGGAGTGG + Intronic
1176131759 20:63499295-63499317 CGCCGCGGGCGGGGGCGGGGCGG + Exonic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176856993 21:13981383-13981405 CACTGCCGGCGGCGCCGGGGTGG - Intergenic
1176867604 21:14062840-14062862 CACTGCCGGCGGCGCCGGGGTGG + Intergenic
1177834017 21:26170422-26170444 GTCCGCAAGCGGGGGCGGAGAGG + Intronic
1179626828 21:42653739-42653761 CGCCGCGGGAGGCGGGGGAGGGG - Exonic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1179994557 21:44967987-44968009 CTCAGCAGGGGGCGGGGGAGGGG - Intronic
1180095895 21:45555231-45555253 CGGCGCAGGGGGCGGCGCAGGGG + Intergenic
1180095900 21:45555243-45555265 CGGCGCAGGGGGCGGCGCAGGGG + Intergenic
1180095905 21:45555255-45555277 CGGCGCAGGGGGCGGCGCAGGGG + Intergenic
1180095910 21:45555267-45555289 CGGCGCAGGGGGCGGCGCAGGGG + Intergenic
1180095915 21:45555279-45555301 CGGCGCAGGGGGCGGCGCAGGGG + Intergenic
1180871789 22:19150563-19150585 CCCCGCGGGCGGCGGCGAGGCGG - Intergenic
1181026633 22:20131164-20131186 CACCTTAAGCGGCGGCGGGGCGG + Intronic
1181107744 22:20584856-20584878 CACCGGGGGCGGTGGGGGAGTGG - Exonic
1184233602 22:43171447-43171469 CAGGGCAGGCGGGGGCGGGGAGG - Intronic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1185278857 22:49961380-49961402 CACGGGCGGCGGCGGCGGCGGGG + Intronic
1185409597 22:50674815-50674837 CGGCGGAGGCGGCGGGGGAGGGG - Intergenic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
950008211 3:9704728-9704750 CACTGCAGGTGGGGGCGGGGAGG - Exonic
950433969 3:12967668-12967690 CCAAGCGGGCGGCGGCGGAGGGG - Exonic
951780201 3:26354473-26354495 CTCTTCAGGGGGCGGCGGAGCGG - Intergenic
954076829 3:48187904-48187926 AAGAGCAGGCGGCGGCGGTGCGG + Exonic
959565102 3:107825907-107825929 CAGAGCAGGCGGGGGTGGAGTGG - Intergenic
962809005 3:138946188-138946210 CGCCGCAGGCGGGTGCGGCGTGG - Exonic
964129640 3:153272564-153272586 CAGAGCAGGAGGGGGCGGAGGGG - Intergenic
966878940 3:184338852-184338874 CACGGATGGCGGCGGCTGAGGGG + Intronic
966887835 3:184386583-184386605 CACCACAGGCGGCGCAGCAGAGG - Exonic
967849551 3:194071415-194071437 CACGCCCGGCGGGGGCGGAGGGG + Intergenic
968674388 4:1870144-1870166 CAGCGGAGGCGGCGCGGGAGAGG + Intergenic
969436590 4:7192609-7192631 CAGCGGAGCCGGCGGCGGGGCGG - Exonic
970333131 4:15004166-15004188 CATGGCGGGCGGCGGCGGAGGGG - Exonic
970500902 4:16676124-16676146 CACCGCAGGGCGTGGAGGAGAGG + Intronic
976389253 4:84492914-84492936 CCCCGCGGGCGGCGGGGTAGGGG - Exonic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
978126960 4:105146604-105146626 CGGCGCAGGCCGGGGCGGAGCGG + Exonic
978763401 4:112379551-112379573 CTCGGCAGGTGGCTGCGGAGCGG + Intronic
981550749 4:145938283-145938305 CAACGGAGGAGGCTGCGGAGGGG + Intronic
983558902 4:169082167-169082189 CACAGCAGGTGGCAGAGGAGTGG - Intergenic
988585656 5:32505359-32505381 CACAGCAGAGGGCGGGGGAGTGG + Intergenic
990376253 5:55173439-55173461 CACCGCGGCAGGAGGCGGAGGGG + Intergenic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
994067115 5:95555452-95555474 CAGCACAGGCGGCGGCGGTGAGG - Intronic
997302324 5:132814514-132814536 CACCGCGGACGGCGGCGGCGCGG - Exonic
997704072 5:135930509-135930531 CACCGCCGGCGGTGGCGACGTGG + Intronic
998200437 5:140114142-140114164 AGCGGCAGGCGGCGGCGGCGCGG + Exonic
1001296727 5:170503993-170504015 CGGCGGAGGGGGCGGCGGAGGGG - Intronic
1002160717 5:177312514-177312536 ATGCGCAGGCGCCGGCGGAGGGG + Intronic
1002638326 5:180618977-180618999 CGCCGCGGGCGGCGGGGGAATGG - Intronic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1003315030 6:5004105-5004127 CGCCCCTGGCGGCGGTGGAGTGG + Intergenic
1003345376 6:5261296-5261318 GACCGCAGCCGGCGTGGGAGGGG - Exonic
1006472663 6:34237336-34237358 CCGCGGCGGCGGCGGCGGAGGGG + Intronic
1007390238 6:41546500-41546522 CGGCGCAGGCGGCGGCGGCGCGG + Exonic
1010044112 6:71420590-71420612 CTCCGCCGGCTGCGGCCGAGAGG - Intergenic
1013099455 6:106974813-106974835 GGCGGCGGGCGGCGGCGGAGGGG - Intronic
1013369233 6:109455517-109455539 GACCGCGGGCGGCAGCGGTGGGG + Intronic
1016949449 6:149566259-149566281 CTCCCCGGGCGGCCGCGGAGAGG - Intergenic
1016982292 6:149864279-149864301 CGCCGCAGGCCGGGGCGGAGAGG - Intergenic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1017872900 6:158502086-158502108 CACCGCAGCTGGCAGCTGAGGGG + Exonic
1017945562 6:159094089-159094111 CAGCGCGGGCGGAGGCGCAGAGG + Intergenic
1019393759 7:805373-805395 AACCCCAGGCGGGGGCAGAGCGG - Intergenic
1020275488 7:6622242-6622264 AGCCGCAGGGGGCGGCGGAGCGG + Exonic
1020292099 7:6730035-6730057 CAGCGGAGGCGGAGGCGAAGGGG + Intergenic
1020784452 7:12556414-12556436 CACTGCCGGGGGCGGCGGGGCGG + Intergenic
1021450213 7:20777833-20777855 CACCGGAGGCTGCTGCGGCGTGG - Intergenic
1022814998 7:33905209-33905231 CAGCCCGGGCGGCGGCTGAGCGG + Intronic
1024049424 7:45609425-45609447 CACGACAGGCCGCTGCGGAGGGG + Intronic
1025729942 7:64100249-64100271 CCCCGCAGACGGCTGCCGAGCGG + Intronic
1025929411 7:65982197-65982219 CGCCGCAGACGGTGGCCGAGCGG - Exonic
1025990165 7:66491552-66491574 CCCGGCAGGGGGCGGGGGAGGGG + Intergenic
1029439700 7:100580192-100580214 CACCGGAGGCGCAGGCGCAGTGG - Intronic
1032097595 7:128947341-128947363 CACCACGGGCGGCTGCAGAGTGG - Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1034892739 7:154855084-154855106 AACTGGAGGCGGCGGCGGTGAGG + Intronic
1035171468 7:157019587-157019609 CTCCGCCGGCGGCGGCCGATGGG - Intergenic
1035613984 8:988974-988996 CAGTGCAGGCAGCGACGGAGAGG - Intergenic
1036561930 8:9905665-9905687 CACTGCTGGCGGCGGCGGCCGGG + Intergenic
1038481999 8:27908321-27908343 CACCGCAGGAGGTGGCCAAGGGG - Intronic
1039212818 8:35235802-35235824 CACCGCAGGCGGCGGCGGAGGGG + Exonic
1041192136 8:55365200-55365222 CACAGCAGGCTGCGGAAGAGTGG - Intronic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1045021224 8:98045887-98045909 CGCCGGAGGCTGAGGCGGAGAGG + Intronic
1049462158 8:142735207-142735229 CATGGCAGGCGGCGGGGCAGGGG + Intronic
1049585217 8:143429875-143429897 CTTCGCGGGCGGCGGCGGAGCGG - Exonic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049724198 8:144137942-144137964 ACCTGCAGGCGGCGGCGGTGCGG + Exonic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1049896239 9:113906-113928 CACCGGGGGCGGCGGCGCAGAGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052824880 9:33167347-33167369 CGCCCGAGGCGCCGGCGGAGAGG + Exonic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1054434066 9:65196021-65196043 CGCGGCGGGCGGCGGCGGCGCGG - Intergenic
1054434072 9:65196039-65196061 CGCGGCGGGCGGCGGCGGCGCGG - Intergenic
1054820450 9:69516208-69516230 CCCCGCGGGCGGCGGCGAGGCGG - Exonic
1059299020 9:113298018-113298040 CACAGCAGGCGGCGCCGGGCTGG + Exonic
1060555278 9:124504741-124504763 CCTCGCCGGCGGCGGCGGCGCGG - Intronic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1060849193 9:126860677-126860699 TGGCGCCGGCGGCGGCGGAGGGG + Intronic
1061194567 9:129100754-129100776 CAGGGCAGGAGGCTGCGGAGGGG - Intronic
1061472118 9:130835196-130835218 AGGCGCAGGCGGCGGCGGGGCGG + Intronic
1062570557 9:137183122-137183144 CACCTCAGGTAGCGGCGGATAGG + Exonic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1062718648 9:138023511-138023533 CCCCGGAGGAGGCGGCCGAGCGG + Exonic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1185497025 X:563124-563146 CACCGCAGGCTGGGGTGCAGTGG + Intergenic
1187464431 X:19515111-19515133 CGCGGCAGGCGGCAGCGGCGAGG - Exonic
1187709577 X:22040014-22040036 CACCGAAAGCGGCGGTGGGGAGG + Intronic
1190063393 X:47224711-47224733 CGACGGAGGCGGCGGCTGAGGGG - Exonic
1191878660 X:65822443-65822465 CACCGGAGGCGGAGGCAGCGTGG - Intergenic
1192313116 X:70032641-70032663 CACCCCAGGCAGGGGTGGAGGGG - Intronic
1194383607 X:93225036-93225058 CACCGCAGGCGGAGGCGGAGGGG + Intergenic
1196920527 X:120580872-120580894 CACCGCACCCGGCCGAGGAGAGG - Intergenic
1197346255 X:125327684-125327706 CACCGGAGGGGGCAGTGGAGGGG + Intergenic
1198099897 X:133414712-133414734 CGGCGCAGGGGGCGGCGGGGCGG + Intronic