ID: 1039216550

View in Genome Browser
Species Human (GRCh38)
Location 8:35278235-35278257
Sequence GAGTGTGGCCAGAGGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039216550_1039216558 22 Left 1039216550 8:35278235-35278257 CCGGCTGCCCTCTGGCCACACTC 0: 1
1: 0
2: 7
3: 58
4: 468
Right 1039216558 8:35278280-35278302 CCTAATGGCCAGTAGTGAGCTGG No data
1039216550_1039216554 7 Left 1039216550 8:35278235-35278257 CCGGCTGCCCTCTGGCCACACTC 0: 1
1: 0
2: 7
3: 58
4: 468
Right 1039216554 8:35278265-35278287 GCCCTGACACTGTTACCTAATGG No data
1039216550_1039216559 23 Left 1039216550 8:35278235-35278257 CCGGCTGCCCTCTGGCCACACTC 0: 1
1: 0
2: 7
3: 58
4: 468
Right 1039216559 8:35278281-35278303 CTAATGGCCAGTAGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039216550 Original CRISPR GAGTGTGGCCAGAGGGCAGC CGG (reversed) Intronic
900185349 1:1330797-1330819 CAGTCAGGCCAGTGGGCAGCCGG - Intergenic
900425515 1:2576643-2576665 TGGTGTGCCCAGAGGGCGGCTGG + Intergenic
900432402 1:2609129-2609151 GAGTGAGGCCGCAGGGCAGCTGG + Intronic
900484118 1:2913424-2913446 GAGTGTGGTCACAGCCCAGCAGG + Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
900883982 1:5402584-5402606 GCCTGTGGCCAGAGGGGAGCTGG + Intergenic
900958332 1:5902307-5902329 GAGGTTGGCCAGACAGCAGCAGG - Intronic
901204936 1:7489195-7489217 GAGTGTGTCTAGGGGGCGGCAGG - Intronic
901430247 1:9209716-9209738 GGCTGTGGGCAGAGGACAGCGGG - Intergenic
902287576 1:15416479-15416501 AGGTGTGGCCAGATGGGAGCCGG + Intronic
902296386 1:15470014-15470036 AAGCATGGCCAGATGGCAGCAGG + Intronic
902299182 1:15489301-15489323 AAGCATGGCCAGATGGCAGCAGG + Intronic
902521744 1:17021938-17021960 GAACCTGGCCAAAGGGCAGCCGG + Intronic
902771204 1:18646600-18646622 GACTGTGCCGAGAGGGCGGCGGG - Intronic
903137746 1:21320456-21320478 GAGTTTGGCCAGAAGTCAGTGGG + Intronic
903166689 1:21525218-21525240 CCGTTTGGCCAGAGGCCAGCTGG - Intronic
903466259 1:23554536-23554558 GAGTGTGGCCCCAGGCCCGCTGG - Intergenic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
904494757 1:30880341-30880363 GAGGGAGGCCAGGGGGCAGAGGG + Intronic
904526207 1:31135847-31135869 GGGTGTGGTCAGTTGGCAGCTGG + Intergenic
904684640 1:32251340-32251362 GAATGGGGCCAGAGGGCTCCCGG + Exonic
904745646 1:32709099-32709121 GAGAGGCACCAGAGGGCAGCAGG + Intergenic
905180066 1:36160114-36160136 AAGTTAGGCCACAGGGCAGCTGG + Intronic
905371612 1:37485473-37485495 GGCTGTGGCCAGCTGGCAGCTGG - Intergenic
905793297 1:40801708-40801730 GAGTGCTGACACAGGGCAGCTGG - Intronic
905804525 1:40866138-40866160 GAGTGTGGACAGAGTGCAGTGGG + Intergenic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
907193143 1:52665386-52665408 GGGTGGGGACAGAGGTCAGCAGG + Intronic
907295584 1:53450426-53450448 GGGGGTGGCCATCGGGCAGCAGG + Intergenic
910758511 1:90714339-90714361 GAGAGAGACCAAAGGGCAGCTGG - Intronic
910759438 1:90719754-90719776 GACAGTGGCCAGAGGGGTGCGGG + Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912758197 1:112342437-112342459 GGCTGTGGCCAGAGGTCAGTGGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
915075422 1:153304576-153304598 GAAAGTGACCAGAAGGCAGCAGG - Intronic
915447897 1:155984559-155984581 GAGGGCGGGCAGTGGGCAGCAGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
917749059 1:178037971-178037993 GGGAGTGGCCAGAGCGCGGCAGG + Intergenic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
921100595 1:211925238-211925260 GGGTGTGGCCAGGGGACACCTGG - Intergenic
921594929 1:217044336-217044358 GAGTGTGTACAGATGGCAGGAGG - Intronic
921625589 1:217374750-217374772 GGGTGTGGCCAGATGAAAGCTGG - Intergenic
922194875 1:223351366-223351388 GAGTGGGGACTGAGGGCACCTGG - Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922464629 1:225838688-225838710 GGGTATGGCCTGCGGGCAGCTGG - Exonic
922741959 1:228019059-228019081 GAGTATGGCCAGGGTGCAGGTGG - Intronic
922803892 1:228375996-228376018 CTGTGTGGCCAGGCGGCAGCTGG + Exonic
923331722 1:232931523-232931545 GAGTGAGGCAAGAAGGCATCTGG + Intergenic
1063812719 10:9732110-9732132 GAGTGTGGGGAGCAGGCAGCTGG + Intergenic
1065045855 10:21747185-21747207 GAGTGTGGACAGTTGGCAGAGGG + Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1069583542 10:69581417-69581439 GAGTGTGGGCAGTGGGTAGGGGG - Intergenic
1069678376 10:70266052-70266074 GAGTGCGGGCAGTTGGCAGCAGG - Intronic
1069769017 10:70886036-70886058 GTGGGTGACCAAAGGGCAGCAGG + Intronic
1069819814 10:71220446-71220468 GTGTGTGGAAAGAGAGCAGCTGG - Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070159778 10:73859257-73859279 GACAGTGGCCAGCGGGCTGCAGG + Intronic
1070544157 10:77439635-77439657 GAAAGTGGCCAGGGGACAGCAGG + Intronic
1070564227 10:77591235-77591257 GAGTGAGGCCAGGTGCCAGCAGG + Intronic
1070703309 10:78618914-78618936 GAGTCCAGCCAGTGGGCAGCTGG - Intergenic
1070791483 10:79192119-79192141 GAGTATGGCCAGAGGATGGCAGG + Intronic
1070793123 10:79201498-79201520 TGTTGTGGCCAGAGGGCAGTTGG + Intronic
1071321778 10:84467377-84467399 AAGTGTGTCCAGTGGGCAACTGG - Intronic
1071397270 10:85236753-85236775 GATTGATGCCAGAGGGCAGGAGG + Intergenic
1072048066 10:91676794-91676816 GAGTATGGCCCAAAGGCAGCTGG + Intergenic
1073205101 10:101764898-101764920 AAGTGTGTCCAGGGAGCAGCAGG + Intergenic
1074185729 10:111098217-111098239 GAGTGTGGGCAGGAGGCTGCAGG - Intergenic
1074216889 10:111393993-111394015 GAGAATGGCCACAGAGCAGCAGG + Intergenic
1074559863 10:114525805-114525827 GAGTTTGGCCATAAGCCAGCAGG - Intronic
1075283322 10:121160385-121160407 CAGTTTGGCCAGAGCTCAGCAGG - Intergenic
1075344596 10:121673021-121673043 GAGTTTGCCCAGAGGGCAAGAGG + Intergenic
1075480338 10:122775632-122775654 GTGTGTGGCAAGAAGGCAGATGG + Intergenic
1076238413 10:128883616-128883638 CAGTGAGGCCAGCTGGCAGCGGG - Intergenic
1076436171 10:130443552-130443574 GTGTGTGGCCCTAGGTCAGCAGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1077241398 11:1512396-1512418 GAGAGTGGGCAGTGGGCAGCAGG - Intergenic
1077299820 11:1841746-1841768 CAGTGTGGTCAGTGGCCAGCGGG + Intergenic
1077316109 11:1920064-1920086 GGGAGTGGCCTGAGGGCAGGAGG + Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1077920451 11:6638146-6638168 GAGTCTGGCCAGAGGACAAGAGG + Intronic
1078339622 11:10489432-10489454 TGTTGTGGCCAGAGGGCAGCTGG - Intronic
1078877831 11:15415779-15415801 AATTGTGGCAAGAGGGCAGGGGG - Intergenic
1079043159 11:17077542-17077564 GAGTGTGGGCAGCGGGCCGAGGG - Intronic
1079748517 11:24164079-24164101 GAGTGGGGCCAGATTGCAGAGGG - Intergenic
1080485680 11:32704494-32704516 GAGGGAGGCCAGAGGGCTGAGGG + Intronic
1080641047 11:34158536-34158558 GACTGAGGCCAGGAGGCAGCTGG - Intronic
1081755441 11:45541002-45541024 GAATGTGGGCTGAGGCCAGCTGG - Intergenic
1081962804 11:47150767-47150789 TAGTGTGGCCAGAATGCAGTGGG + Intronic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1083592564 11:63904174-63904196 TAGGGTGGGCTGAGGGCAGCAGG - Intronic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1083733867 11:64668682-64668704 AGGAGGGGCCAGAGGGCAGCAGG + Intronic
1084174495 11:67416252-67416274 GAGTGGGCCCAGAGGACAGCAGG + Intronic
1084501952 11:69540272-69540294 GAGCCGGGCCAGCGGGCAGCTGG - Intergenic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085346630 11:75772272-75772294 GAGTGTGGGTAGGGGGCAACTGG - Intronic
1087230064 11:95651023-95651045 GAGTGTGGCCAGTGGGTCACTGG - Intergenic
1088259350 11:107929123-107929145 GAGTTTGGGAAGAAGGCAGCCGG - Intronic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1089518346 11:119047866-119047888 GAGTGTGGGGAGTGGGAAGCTGG + Intronic
1090400877 11:126447484-126447506 GAGGGTGGCCTGAGAGCACCGGG - Intronic
1091402836 12:191046-191068 GGGTGTGGCCAGAGGCCAGGCGG - Exonic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1092206003 12:6614378-6614400 GAGTGCCCCCAGAGGGCAACAGG + Intergenic
1094414803 12:30205151-30205173 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1094414814 12:30205269-30205291 GTGTGTGGCCAGAGACCAGAGGG - Intergenic
1095381924 12:41605242-41605264 GAGTGTGGGAAGAGGTCAGCTGG - Intergenic
1096537184 12:52282609-52282631 GAGAGTGACCATAGGGCAGGAGG + Intronic
1097008272 12:55934451-55934473 GAGTGTTCCCAGAGAGCTGCTGG + Intronic
1097011317 12:55955409-55955431 GGGAGTGGATAGAGGGCAGCTGG - Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1100457795 12:94768917-94768939 GTGTGTGGCCCAAGGGCAGCAGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102010976 12:109618109-109618131 GGGAGTGGCCAGGGGGCAGCAGG - Intergenic
1102225790 12:111227502-111227524 GAGAGTGTCCAGAGCTCAGCTGG - Intronic
1102510920 12:113414858-113414880 GAGGGTGCCCCGAGTGCAGCAGG - Intronic
1102683202 12:114704354-114704376 AAGTGGGGGCAGTGGGCAGCAGG + Intergenic
1103075005 12:117974910-117974932 GGGTGCGGAGAGAGGGCAGCAGG - Intergenic
1103564672 12:121809721-121809743 GGGTGTGTCCAGGCGGCAGCTGG - Exonic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1104073908 12:125372821-125372843 GTGTGTGGCCAGAACGCTGCGGG - Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104714792 12:131009123-131009145 GAGTGTGGCCACCTGGCTGCAGG - Intronic
1106140169 13:27005406-27005428 GAGGGTGGGCAGAGGCCAGTGGG - Intergenic
1107987548 13:45788208-45788230 GAGTGAGGTCACAGGGCTGCTGG + Intronic
1112722357 13:102259252-102259274 GTTTGTGTCCACAGGGCAGCTGG - Intronic
1112848408 13:103672727-103672749 GAGTGTGGGCAGGAAGCAGCAGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1116397844 14:44468335-44468357 GAGTGGGGCCAGAAGGCATGGGG - Intergenic
1117378473 14:55137105-55137127 TAGTGGGGACAGAGGGCAGATGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118448252 14:65871294-65871316 TAGAGTGGCCAGAGAGGAGCAGG + Intergenic
1118796940 14:69152665-69152687 GGGTGGGGACAGAGGGCAGGAGG + Intronic
1118919816 14:70139698-70139720 GAGTTTGGCCAGACAGCTGCTGG + Intronic
1119727698 14:76932065-76932087 GACTGAAGCTAGAGGGCAGCTGG - Intergenic
1119806538 14:77485765-77485787 GGGTGTGGCCTGAGTGAAGCAGG - Intronic
1119884204 14:78126678-78126700 GAGTGTGTCCAGCAGACAGCTGG + Intergenic
1120194448 14:81466929-81466951 GAGCTTGGGCAGAGGGCAGAGGG + Intergenic
1120842118 14:89095222-89095244 GTTTGTAGCCAGATGGCAGCTGG + Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121332115 14:93056173-93056195 GAGAGTGGCCTGGGTGCAGCAGG + Intronic
1121876436 14:97457452-97457474 GTAAGTGGGCAGAGGGCAGCTGG + Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122127922 14:99589160-99589182 GAGTGAGCCCTGAGGACAGCAGG + Intronic
1122127934 14:99589218-99589240 GAGTGAGCCCTGAGGACAGCAGG + Intronic
1122891215 14:104733131-104733153 GAGGGTGGTCTGAGGGCACCTGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1122959144 14:105086736-105086758 GACTGTGGCAAGAGGGGAACAGG - Intergenic
1122998984 14:105281802-105281824 AAGTGAAGCCAGTGGGCAGCAGG + Intronic
1123098322 14:105776796-105776818 GAATGAGGCCAGAGGGCCTCGGG + Intergenic
1123122685 14:105925353-105925375 GGGTGGGGCCTGATGGCAGCTGG - Intronic
1123126805 14:105952697-105952719 GAGTGTGGCTTGAGGCCAGGAGG - Intergenic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1124086954 15:26559945-26559967 GACTGTGGCCACTGGGCAGGTGG + Intronic
1124464585 15:29925366-29925388 GACTGAGGACAGAGGGCATCAGG + Intronic
1124882811 15:33658115-33658137 GAGTCTGGCCACAGTGTAGCTGG + Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1128075176 15:64821342-64821364 CAGTATGTTCAGAGGGCAGCAGG - Intronic
1128085525 15:64883892-64883914 GAGCTTGGCTAGAGGGGAGCAGG + Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1129238223 15:74236495-74236517 GAGGGTGGCCAGGTGGGAGCAGG - Exonic
1129295079 15:74595785-74595807 GAGAGTGGCAAGTGGGAAGCTGG - Exonic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129741819 15:77992964-77992986 GGGTGCGGACAGTGGGCAGCTGG - Intronic
1129747931 15:78038004-78038026 GAGTGTGGCACAAGGGCAGGTGG + Intronic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1130521202 15:84661894-84661916 GCATGTGGCCCGAGGGCCGCGGG + Intergenic
1132038186 15:98503666-98503688 GAGCCTGGCCAGCAGGCAGCTGG + Intronic
1132480151 16:163268-163290 GAGTGGGGACAGTGGGGAGCGGG + Intronic
1132544433 16:526943-526965 GAGAGTGGCCTCAGGGCAGCGGG + Intergenic
1132610799 16:815226-815248 GAGTGTGGCACGTGGGCTGCTGG + Intergenic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133283210 16:4678685-4678707 GCGCGTGGCCAGTGGGGAGCAGG - Intronic
1133803420 16:9103799-9103821 GAGTGCAGCCAGTGGGCAGGTGG + Intronic
1134138141 16:11693822-11693844 GGATGGGGCCAGAGGGCATCTGG - Intronic
1134346329 16:13395105-13395127 GAGTGTGGACAGAGGTTGGCAGG + Intergenic
1134354122 16:13465207-13465229 GAGTTTGGGCAGAGGGCTGCTGG - Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1135624621 16:23982953-23982975 GACTGGGGTCAGAGGGCTGCAGG + Intronic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1135993022 16:27228955-27228977 GAGTGGGCTCAGAGAGCAGCAGG - Intronic
1136542396 16:30935452-30935474 AAGAGTGGAGAGAGGGCAGCAGG + Intronic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1137719770 16:50621290-50621312 GTGTCAGGCCAGAGGGCAGATGG - Intronic
1137720727 16:50625909-50625931 GACTGTGGAGAGAGGGAAGCAGG - Intronic
1138348110 16:56332251-56332273 GAGGGTGGCCAGAGTCCGGCTGG - Intronic
1138366351 16:56480970-56480992 GAGTGTGGGCAGGGGCCAGATGG + Intronic
1138536402 16:57662671-57662693 GAGCGTGGCCAGATGGCGGCGGG + Intronic
1138627796 16:58266245-58266267 GAGAGTGGGTAGAGAGCAGCAGG - Intronic
1139357769 16:66377456-66377478 CAGTGGGCCCAGAGGTCAGCTGG + Intronic
1139372302 16:66476650-66476672 TGGTTGGGCCAGAGGGCAGCTGG - Intronic
1139489688 16:67279629-67279651 GAGTGTCGCCAGCGGGCGACGGG + Exonic
1139504568 16:67392532-67392554 GGGTGTGGCCAGAGGGCTGAGGG - Intronic
1141015645 16:80446749-80446771 GATAGTGGCCAGATGGCAGAGGG - Intergenic
1141705504 16:85662321-85662343 GAGAGTGTGCAGAGGGGAGCAGG + Intronic
1142683327 17:1562607-1562629 GAGAGCGGCCGGCGGGCAGCGGG - Exonic
1142819146 17:2450445-2450467 GAGTGTGGACAGACTGCAGAGGG + Intronic
1143099159 17:4495731-4495753 GAGGATGGGCAGAGGGCAGATGG + Intergenic
1144359475 17:14478255-14478277 GAGTGTGGCCGCTGGGCAGCTGG - Intergenic
1144888101 17:18477595-18477617 GTGTGGGGTCAGAGGGCTGCAGG + Intronic
1144993305 17:19249044-19249066 GAGTCTGGTCAGCAGGCAGCTGG - Intronic
1145144104 17:20466708-20466730 GTGTGGGGTCAGAGGGCTGCAGG - Intronic
1145252449 17:21304057-21304079 GGGTGCTCCCAGAGGGCAGCAGG - Intronic
1145791760 17:27632000-27632022 GCGTGGGGTCAGAGGGCGGCAGG + Intronic
1145940617 17:28741606-28741628 GAGTGTGGACAGGGGCCAGCTGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147246592 17:39125168-39125190 GGCTATGTCCAGAGGGCAGCTGG - Intronic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1148159410 17:45441571-45441593 GACTGTGGTCAGAGGACAGATGG - Intronic
1148325288 17:46779704-46779726 TGCTGTGGCCAGAGGGCTGCAGG + Intronic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149568086 17:57653451-57653473 GACACTGGCCAGAGGGCAGGTGG - Intronic
1149918667 17:60635689-60635711 GAGTGAGGCCTAGGGGCAGCAGG - Intronic
1150368522 17:64613745-64613767 GAGGGGGGGCAGAGGGGAGCAGG + Intronic
1150390745 17:64788656-64788678 GACTGTGGTCAGAGGACAGATGG - Intergenic
1150512792 17:65774518-65774540 GTGTGTGGTCAGGGGGCAGTGGG - Intronic
1150625764 17:66840182-66840204 GAGAGAAGCCAGAGGGCAGGTGG + Intronic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151462323 17:74261735-74261757 GAATGGGGCCACAGGGCAGCCGG + Exonic
1151572223 17:74932562-74932584 AGGTGGGGCCAGAGGGCAGGGGG - Intronic
1151713895 17:75821800-75821822 GCGAGTGAGCAGAGGGCAGCTGG + Intronic
1152160680 17:78666804-78666826 ATGTGTGGCCCCAGGGCAGCCGG + Intergenic
1152259167 17:79257510-79257532 GGGTTTGGCCAAAGGGCTGCAGG + Intronic
1152375974 17:79919245-79919267 GAGGGTGTGCAGAGGTCAGCGGG - Intergenic
1152474693 17:80510368-80510390 GGGTGTGTCCAGTGCGCAGCTGG - Intergenic
1152527244 17:80895349-80895371 GAGCAGGGTCAGAGGGCAGCTGG - Intronic
1152584733 17:81183830-81183852 CTGTGTGGCCAGTGAGCAGCTGG - Intergenic
1153764505 18:8362572-8362594 GGGAGTTGGCAGAGGGCAGCTGG - Intronic
1153996224 18:10444251-10444273 GAGTGGGGCCACAGGCCAGCAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156888675 18:42165155-42165177 GAGTCTTGCCAGTGGGAAGCAGG + Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1159417614 18:68173308-68173330 GAGTCTGGCAACGGGGCAGCCGG - Intergenic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160098690 18:75900838-75900860 AAGTGAGGCCTGAGGGCAGTGGG - Intergenic
1160574772 18:79846959-79846981 TCGTTTGGCCACAGGGCAGCCGG + Intergenic
1160875068 19:1293107-1293129 AACTGAGGCCAGAGGGCAGTGGG + Intronic
1160923201 19:1530113-1530135 GAGTGTGGCCTGTGGGCACAGGG - Intronic
1161332730 19:3696098-3696120 TAGTGTGGTCACAGGGCGGCCGG - Intronic
1161486239 19:4537342-4537364 CAGTGTGGCCAGGGCTCAGCTGG + Exonic
1162637550 19:11981909-11981931 TAGAGTGGAAAGAGGGCAGCAGG + Intergenic
1162757432 19:12868657-12868679 GAGGGTGGGCAGAGGTCACCTGG - Exonic
1162926743 19:13934022-13934044 GAGTCTGGGATGAGGGCAGCGGG + Intronic
1163260838 19:16188917-16188939 TGGTGTGGTCAGATGGCAGCTGG + Intronic
1163290552 19:16376737-16376759 CAGAGTGGCCACAGGGCTGCCGG + Intronic
1163848531 19:19650782-19650804 CAGTGTTGCCACAGGGCTGCTGG - Intronic
1164454771 19:28397945-28397967 AATTGTGGCCACAGGGCCGCAGG + Intergenic
1164616218 19:29668238-29668260 CAGTGTGGCCCCAGGGCTGCTGG - Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1166169726 19:41019252-41019274 GCCTGTGGCCAGTGGGAAGCTGG + Intergenic
1166197672 19:41217725-41217747 GAGCTTGCCCTGAGGGCAGCAGG + Intergenic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
1168507157 19:56945932-56945954 GAGTGTGGCCAGGGGACTGGAGG + Intergenic
925745566 2:7040661-7040683 GACTGAGGCCAGAGGCCAGACGG - Exonic
926107902 2:10163692-10163714 GAGCGCGGCCACTGGGCAGCCGG - Intronic
926163961 2:10506612-10506634 GAGTGTGGCAGGAGGGGTGCAGG - Intergenic
926313898 2:11695695-11695717 GCGGGTGGCCAGAGGGAAGCTGG + Intronic
926560048 2:14406827-14406849 GTGCGTGGCCAGGGGGCAGGGGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927362041 2:22247478-22247500 GAAGGTGGCCAGAGGTCTGCTGG - Intergenic
927518444 2:23685592-23685614 GAGCCTGCCCACAGGGCAGCTGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
928876045 2:36041474-36041496 AAGTGTGGCAAGAGGGCAGCTGG - Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931790280 2:65658462-65658484 GAGTGGGGCCAGGGGTCACCTGG + Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932397670 2:71459298-71459320 GAATGTGGCCAGAGGAGAACTGG + Intronic
934511319 2:94946667-94946689 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
934904513 2:98187077-98187099 GAGTGTGGCCATAGCGAGGCTGG - Intronic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935202102 2:100866080-100866102 GTGTGTGGCCAGACAGCTGCAGG - Intronic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
937911140 2:127076103-127076125 GAGAGAGGGCTGAGGGCAGCTGG - Intronic
938072885 2:128317725-128317747 TAAGGTGGCCCGAGGGCAGCGGG + Intronic
938108443 2:128548910-128548932 GAGCCTGGTCAGAGGACAGCAGG - Intergenic
938207628 2:129437715-129437737 CAGTGTGGCCAGCTGCCAGCCGG + Intergenic
938388283 2:130883236-130883258 GAGGGTGGCCAGTGGGCATGGGG + Intronic
938732407 2:134156848-134156870 TGGTGTGGCCAGAGTGCAACTGG + Intronic
941185534 2:162318029-162318051 GCGGGCGGCCAGAGGGCTGCCGG + Exonic
941694673 2:168538297-168538319 AAGTGGGGTCAGAGAGCAGCAGG - Intronic
941734979 2:168964340-168964362 GACTGTGGCCAGATTGGAGCAGG + Intronic
942345311 2:174996738-174996760 GAGAGAGGAGAGAGGGCAGCTGG - Intronic
946024247 2:216662217-216662239 AAGTGAGGCCGGTGGGCAGCTGG - Intronic
946033425 2:216723298-216723320 GAGTGGGGTTAGAGGGCAGAAGG - Intergenic
946054553 2:216889411-216889433 GAGAGAGGCCAGAAGCCAGCAGG + Intergenic
946080387 2:217113647-217113669 GAGTGTGGTAAGTGGGCAGCTGG - Intergenic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
947526196 2:230878147-230878169 GAGGAGGGCCAGAGAGCAGCCGG - Exonic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947605055 2:231480901-231480923 GGGAGGGGCCAGAGGGAAGCTGG - Intronic
947698071 2:232209534-232209556 GAGTGTGGCATGGGGGCAGAAGG + Intronic
947791349 2:232871112-232871134 GAGTTGGACCAAAGGGCAGCTGG + Intronic
948285475 2:236781285-236781307 GCATGTGGCCCGAGGGCCGCAGG + Intergenic
948382392 2:237559812-237559834 GGGTGTGGACAGAGGACAGGTGG - Intergenic
948676625 2:239600799-239600821 GGATGTGGCCTGAGTGCAGCTGG - Intergenic
948694758 2:239727576-239727598 GAGTGAGGAGAGAGTGCAGCCGG + Intergenic
948805467 2:240452037-240452059 GAGTGCGGCCAGAGGGGAACTGG + Intronic
948829569 2:240591707-240591729 GTGTGTGGGCAGAGGACTGCAGG + Intronic
948906487 2:240982067-240982089 GGCTGTGCACAGAGGGCAGCAGG + Intronic
1169141664 20:3230291-3230313 GGGTGTGGTCAGGGGGCAGGTGG + Intronic
1170728145 20:18948170-18948192 GGGTGAGGCCAGAGGTGAGCTGG + Intergenic
1171020573 20:21581012-21581034 GAAAGTGGCCAGAGGGCTGGGGG - Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1172217455 20:33246309-33246331 TACAATGGCCAGAGGGCAGCAGG - Intergenic
1172758148 20:37301958-37301980 GACTGTGGCCAGAGCACAGAGGG + Intronic
1173317699 20:41959887-41959909 GAGTGGGGCCAGGAGGGAGCTGG - Intergenic
1173385551 20:42584153-42584175 GAATGTGGACAGAGCTCAGCTGG - Intronic
1173923986 20:46767230-46767252 AAGTGAGGTCAGAGTGCAGCTGG + Intergenic
1174034642 20:47661139-47661161 GAGAGTGGCGGGAGGGCATCGGG - Intronic
1174413862 20:50353911-50353933 GCGGGAGGCCAGAGGGGAGCAGG + Intergenic
1175076811 20:56382292-56382314 GACTGTGGCCAGCGGGAAGCAGG + Intronic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175295870 20:57908364-57908386 CAGAGAGGCCTGAGGGCAGCAGG + Intergenic
1175641404 20:60633578-60633600 GTGTGTGCCCAGAGGCCAGCAGG + Intergenic
1175920980 20:62450589-62450611 GACTGTGCCCAGGGGGCAGGCGG + Intergenic
1175943074 20:62546807-62546829 GAGTGCAGCAAGAGGGGAGCCGG - Intergenic
1175943213 20:62547375-62547397 TGGTGTGTCCAGCGGGCAGCAGG - Intergenic
1176147806 20:63573244-63573266 GACTGAGGCCAGAGGACATCTGG + Intronic
1176199834 20:63855261-63855283 AGCTGTGGCCACAGGGCAGCGGG + Intergenic
1176240925 20:64075510-64075532 GGGGGTGGCCAGGGGGCAGTCGG - Intronic
1176242615 20:64082111-64082133 GAGTTTGGCCAGACGACACCAGG + Intronic
1176257729 20:64160843-64160865 GGGTGTGTGCAGAGGCCAGCTGG + Intronic
1176270180 20:64232232-64232254 GCGGGCGGCCAGTGGGCAGCCGG - Exonic
1178431500 21:32522196-32522218 GAGTGTGGCCAGGGGACGGAAGG - Intergenic
1179056909 21:37944739-37944761 GAGTCTGGGCAGGGGGCTGCTGG + Intergenic
1179874667 21:44261899-44261921 GCGGGTGGCCAGAGGTCACCAGG + Exonic
1179894227 21:44352306-44352328 GAGTGTGGCCAAGGGGCAAAGGG + Intronic
1179897374 21:44370196-44370218 GGGCGTGGCCAGCAGGCAGCTGG + Intronic
1179899672 21:44382941-44382963 AACCCTGGCCAGAGGGCAGCTGG + Intronic
1179947191 21:44686425-44686447 GGGGGTGGCCAGGTGGCAGCAGG - Intronic
1180610990 22:17097867-17097889 GGGTGTGGGCAAAGTGCAGCTGG - Exonic
1181265160 22:21626798-21626820 GAGTGTGGCCAGATCTCAGCAGG + Intergenic
1181277648 22:21696638-21696660 GGGGGTGGCCTGAGGGCAACAGG - Intronic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1181333240 22:22111049-22111071 CAGTCTGGCCAGTGAGCAGCAGG + Intergenic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181522721 22:23458777-23458799 GAGGGTTCCCAGAGGGCTGCCGG + Intergenic
1181528738 22:23504074-23504096 GACTTTATCCAGAGGGCAGCAGG - Intergenic
1182269018 22:29141767-29141789 AAATGTGGCCTGTGGGCAGCAGG - Intronic
1182718101 22:32376304-32376326 CAGTCTGGCGAGAGAGCAGCAGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1184207003 22:43011419-43011441 GAAGGTGGCCAGAGAGCATCTGG + Intronic
1184320679 22:43740016-43740038 TGGTGTGGCCAGAAAGCAGCAGG - Intronic
1184508264 22:44917157-44917179 GAAGGTGTGCAGAGGGCAGCCGG + Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184812970 22:46849593-46849615 GAGGCTGGGCAGTGGGCAGCAGG + Intronic
1185070610 22:48653861-48653883 GAGCGTCACCAGATGGCAGCTGG + Intronic
1185332812 22:50259243-50259265 GGGGGTGTCCAGGGGGCAGCGGG + Intronic
950038326 3:9903039-9903061 GTGGGAGGCCAGAGGACAGCGGG - Exonic
950042594 3:9929900-9929922 GAGTTGGGCCTGGGGGCAGCTGG + Intronic
950534068 3:13569365-13569387 CAGTCTGGCCTGAGAGCAGCTGG - Intronic
952707197 3:36391463-36391485 GAGACTGTCCAAAGGGCAGCAGG - Intronic
952885431 3:38008763-38008785 GAGGGTGGCAGGAGGGCAGCAGG - Intronic
953391199 3:42534894-42534916 GGGTGTGGCATGGGGGCAGCTGG - Intronic
954001915 3:47564395-47564417 GGCTGTGGGCAGTGGGCAGCTGG - Intronic
954152112 3:48662768-48662790 GATGGTGCCCAGAGGGCGGCGGG - Exonic
955158915 3:56445667-56445689 GAGAGTGGCAAGAGGGGAGGCGG - Intronic
957476719 3:80734838-80734860 CAGTGCAGCCAGAGGGCTGCTGG - Intergenic
959129728 3:102339801-102339823 GAGTGAGGACAGGTGGCAGCTGG - Intronic
960353537 3:116622688-116622710 GATGGTTGCCAGAGGCCAGCAGG - Intronic
960358637 3:116683626-116683648 TAGTGTGGCCAGAGATCAGGAGG - Intronic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
962321811 3:134396719-134396741 GAGGCTGGCAGGAGGGCAGCAGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
966815935 3:183889876-183889898 GGGTGTGGCCATAGGGCTGATGG + Intergenic
967337911 3:188364759-188364781 AATGGTGGCCAGAGGGCAGCAGG - Intronic
968001251 3:195208381-195208403 GCGTGTGGGCAGTGGGCAGGTGG - Intronic
968483149 4:845692-845714 GGAGGTGGCCTGAGGGCAGCTGG + Intergenic
968651657 4:1762543-1762565 GAGTCAGGGCAGAGGGCAGAAGG + Intergenic
968788498 4:2642342-2642364 GCGTGTGGCCAGCTGGCAGGTGG + Intronic
968966732 4:3772626-3772648 GAGTGGGGCCAGAGGTCCCCTGG - Intergenic
968986807 4:3880118-3880140 GGCAGAGGCCAGAGGGCAGCAGG - Intergenic
979546953 4:121950783-121950805 GAGAGTGGGCATCGGGCAGCCGG - Intronic
981143941 4:141303461-141303483 AAGTGTGTCCTGAGTGCAGCTGG + Intergenic
982223064 4:153141206-153141228 GACTGTGGGCTGGGGGCAGCTGG - Intergenic
984118501 4:175712313-175712335 TAGTGTGGCCGCAGGGCAGCAGG - Intronic
985012097 4:185593189-185593211 CAGTGTGGGCAGAGGCCAACAGG + Intronic
985258999 4:188097643-188097665 GGGGGTGGCCAGAGTTCAGCAGG + Intronic
985477728 5:89216-89238 GTGTGTGGACAGAGGGGAGGAGG - Intergenic
985655830 5:1130955-1130977 GAGGGTGGTCTGAGGGCTGCTGG + Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
985717684 5:1471821-1471843 GACTCTGGCCAGAGAGCAGGAGG + Intronic
985717923 5:1473058-1473080 GACTCTGGCCAGAGAGCAGGAGG - Intronic
985744115 5:1636933-1636955 GAGAGGGGCCAGAGTACAGCAGG + Intergenic
985888213 5:2696577-2696599 GTGTGGTGCCACAGGGCAGCAGG - Intergenic
986229828 5:5852960-5852982 AGATGTGGGCAGAGGGCAGCAGG + Intergenic
990208048 5:53451286-53451308 GGGTGGGGGGAGAGGGCAGCTGG - Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
990544967 5:56814459-56814481 GAGTGGGGACAGAGGGAACCCGG + Intergenic
990822021 5:59851937-59851959 AAGTGTGGGCAAAGGGTAGCTGG - Intronic
992169703 5:74089560-74089582 AAGTGTCTCCAGAGGCCAGCAGG + Intergenic
996810076 5:127506788-127506810 GAGTGAGGGCTGAAGGCAGCGGG + Intergenic
996847394 5:127915317-127915339 GTATGTGGCCCGCGGGCAGCAGG - Intergenic
996928291 5:128855459-128855481 GTGTGTGCCCAGATGGGAGCTGG + Intronic
999302894 5:150502036-150502058 GAGAGGGGCCAGAGGGCATGTGG + Intronic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1001209313 5:169795416-169795438 GAGGCTCGCCAGAGGGCTGCAGG + Intronic
1001534879 5:172491306-172491328 GTGGGTGGCCAGTAGGCAGCCGG - Intergenic
1002759712 6:192028-192050 GGGCCTGGGCAGAGGGCAGCAGG + Intergenic
1003308579 6:4949456-4949478 TAGTTTGGCCAGAGTACAGCAGG - Intronic
1004903003 6:20211185-20211207 GGGTGTGCGCAAAGGGCAGCAGG + Intronic
1005822297 6:29607891-29607913 CAGTGAGGCCAGAGTGCAGCTGG - Intronic
1006027746 6:31158182-31158204 GGGTGTGGCCAAAGCGCAGTAGG - Intronic
1006105047 6:31711376-31711398 GGGTGTGACCTCAGGGCAGCAGG - Intronic
1006155540 6:32011088-32011110 GAGGGTGGGCAGAGTGCAGGGGG + Intergenic
1006161872 6:32043942-32043964 GAGGGTGGGCAGAGTGCAGGGGG + Intronic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006445908 6:34079736-34079758 GCCTGTGGCCAGAGGGCTGGAGG - Intronic
1006838896 6:37015643-37015665 GAGTGTGTTCAAAGGGGAGCGGG + Intronic
1006898163 6:37483861-37483883 AAGTGTGGCCATAGAGCAGCAGG - Intronic
1007357389 6:41331650-41331672 GAGCGGGGACAGAGGGGAGCCGG + Intergenic
1007397225 6:41584894-41584916 GAGTCTGGCCCCAGGGCAGCTGG + Intronic
1007809332 6:44475242-44475264 GAGTGTGGGCAGTGATCAGCTGG + Intergenic
1010474035 6:76263973-76263995 GGGTGTGGCAAGAGTGGAGCTGG + Intergenic
1011029754 6:82909046-82909068 GAGTGTGGCAAGTGTGCAGGTGG + Intronic
1011610481 6:89146112-89146134 GAGAGGGCGCAGAGGGCAGCGGG + Exonic
1013517209 6:110899369-110899391 GGGTGTGTCCAGAAGGCACCTGG + Intergenic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1014436379 6:121425265-121425287 GAGTGGGGCCTGTGGGCAGGAGG - Intergenic
1016989181 6:149917842-149917864 GTGTGTGGCCTGCAGGCAGCAGG - Intronic
1016993935 6:149947771-149947793 GTGTGTGGCCTGCAGGCAGCAGG + Intronic
1017001348 6:149999728-149999750 GTGTGTGGCCTGCAGGCAGCAGG - Intergenic
1017004398 6:150019766-150019788 GTGTGTGGCCTGCAGGCAGCAGG - Intronic
1017011071 6:150064247-150064269 GTGTGTGGCCTGCAGGCAGCAGG - Intronic
1017161949 6:151373333-151373355 GAGTGAGGCCACAAGGGAGCAGG + Intronic
1017223734 6:151996000-151996022 GAGTGTGGCCTGAACCCAGCAGG - Intronic
1017894483 6:158667468-158667490 GAGAGAGGACAGAGGGCTGCGGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018298200 6:162372020-162372042 GAGGCTGGACAGAGGGCATCTGG - Intronic
1019003455 6:168776333-168776355 GAGTGAGGCCAGAGGACAACGGG + Intergenic
1019303764 7:322659-322681 GGGAGGGGCCTGAGGGCAGCCGG - Intergenic
1019409486 7:900369-900391 GAGTGAGGCAGGAGGGCTGCAGG + Intronic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019588604 7:1817760-1817782 GAGGGTTCCCAGAGGGCTGCCGG - Intronic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1023857870 7:44196184-44196206 GAGTGAGGCCAGAGAGGAGCAGG + Intronic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1026560493 7:71444381-71444403 TAGTGTGGCCACATGGCAGGAGG - Intronic
1026994657 7:74607624-74607646 GAGGGTGGCCCGAGGGGAGCAGG - Intergenic
1027224894 7:76237653-76237675 GAGTGTGGGCAGAGGACAAGAGG + Intronic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1029139765 7:98401248-98401270 GGGCGTGGCCAGAGGGAAGCGGG + Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032421394 7:131782663-131782685 GGATGTGGCCAGAGGCCTGCAGG - Intergenic
1032572981 7:133020960-133020982 GAGGGGGGCCGGCGGGCAGCAGG + Intronic
1033258388 7:139821304-139821326 GAGGATGTCCAGTGGGCAGCTGG + Intronic
1034412989 7:150950886-150950908 GAGCGTGGCCAGTGGGTGGCAGG - Intronic
1035769842 8:2138343-2138365 GACTGTGGACTGAGAGCAGCTGG + Intronic
1035836160 8:2754410-2754432 GGGTGGGGCCAGAGGGTAGATGG + Intergenic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037834587 8:22208579-22208601 GAGTGTGCCCAGGTGACAGCAGG + Intronic
1038356254 8:26831954-26831976 GAGTGGGGACAGAGGCCTGCTGG + Intronic
1038529456 8:28306140-28306162 GAGTGGGGGCAGAGGGCAGGTGG - Intergenic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039971748 8:42326407-42326429 GAGTGGGGGCAGAGGGCTTCAGG - Intronic
1041468360 8:58180605-58180627 GAGTGGGGCCAGAGAGCAGAAGG + Intronic
1042937181 8:74071417-74071439 GAGGGTGGCCAGAGGAGAACTGG - Intergenic
1044250701 8:90001531-90001553 GAGCGAGGCCACAGGGCAGCCGG - Exonic
1044999650 8:97868868-97868890 GAGTGGAGCCAGGTGGCAGCAGG + Intronic
1047755360 8:127913945-127913967 GTGTGAGGCCAGGGGGCTGCTGG - Intergenic
1048000788 8:130377888-130377910 AAGTGTGGGCAGTGGGCAGGGGG - Intronic
1048754531 8:137722308-137722330 GTGTGTGGGCAGAGGGCATATGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049412309 8:142478721-142478743 GAGTGTGGCCATGGGGTAGCGGG + Intronic
1049674181 8:143882544-143882566 GGCTTTGGCCAGAGGGCCGCTGG - Intergenic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1050589210 9:7145178-7145200 GTGCGTGGCCAGAGGGTGGCGGG + Intergenic
1051361273 9:16283663-16283685 GAGTGTGGCAAGAGGGAATCAGG - Intergenic
1051798780 9:20907484-20907506 GAGGATGTCCAGAAGGCAGCAGG - Intronic
1052025356 9:23567948-23567970 CAGTGTGGCCAAAAAGCAGCTGG - Intergenic
1053481868 9:38422082-38422104 GAGTGAGGCCAGATGGCAGATGG - Intronic
1053654056 9:40197600-40197622 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1053904443 9:42826776-42826798 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054366171 9:64343816-64343838 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054530542 9:66178738-66178760 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
1054673801 9:67833546-67833568 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1056137329 9:83643042-83643064 GTGTGTGGACACAGGGCTGCCGG - Intronic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056331160 9:85522462-85522484 GTGTGTGTCCAGAGGGCTGGTGG - Intergenic
1056588339 9:87944107-87944129 GAGTGTGCCAACAGGGCAGGTGG + Intergenic
1056602988 9:88061116-88061138 GAGTGTGGACAGCAGGCATCTGG - Intergenic
1057758329 9:97853975-97853997 GAGCGCGGCGAGACGGCAGCAGG + Exonic
1058189704 9:101898335-101898357 GTGTGTGGCAAGAGGGCAGGGGG + Intergenic
1058433421 9:104939706-104939728 GGGTGTGGCCAGTGGGCCCCTGG - Intergenic
1059391517 9:114002318-114002340 GCGTGAGGCCAGTGGGGAGCAGG - Intronic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1059476278 9:114550525-114550547 CACTGTGGCCAGGGGGCAACTGG + Intergenic
1060198527 9:121638619-121638641 AAGAGTGGCCAAAGGCCAGCAGG + Intronic
1060246443 9:121950540-121950562 GAGTCTGACCTGAGGCCAGCAGG + Intronic
1060602430 9:124887082-124887104 GAGAGAGGCCAGAGGACCGCAGG + Intronic
1061255376 9:129452078-129452100 GACTTTATCCAGAGGGCAGCGGG + Intergenic
1061389916 9:130311754-130311776 GAGGGTGGGGAGGGGGCAGCAGG + Intronic
1061678700 9:132232080-132232102 CATTGTGGCCAGACGGCTGCAGG + Intronic
1061791859 9:133063277-133063299 GAGACTGGCCAGAGGGCCTCAGG - Intronic
1062247375 9:135576135-135576157 GAGTGTGGCCAGAGGCCGAGCGG - Intergenic
1062710140 9:137971074-137971096 GAGAGTGGCCTGGGGGCATCAGG + Intronic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1185466533 X:358361-358383 GACTGTGGGCAGAGGCCAGCAGG - Intronic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1187724986 X:22192813-22192835 GACTCTGGTCAGAGGACAGCCGG + Intronic
1189359748 X:40340697-40340719 GAGTGTTGACAGCTGGCAGCTGG - Intergenic
1190741471 X:53291728-53291750 GAGTGGGGTGAGAGGGCAGTTGG - Intronic
1192639581 X:72849086-72849108 CAGTTTGGCCAGAGGCCATCGGG - Intergenic
1192642130 X:72871719-72871741 CAGTTTGGCCAGAGGCCATCGGG + Intergenic
1194348347 X:92794013-92794035 GAGTGGGTCCAGGTGGCAGCTGG - Intergenic
1198655544 X:138909638-138909660 GAGTGTGGTCAAAGAGCAGCGGG + Intronic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200127835 X:153825167-153825189 GAGGGAGGCCAAAGGACAGCTGG - Intronic
1200656675 Y:5910641-5910663 GAGTGGGTCCAGGTGGCAGCTGG - Intergenic
1201587347 Y:15575644-15575666 CTGTGTGGCAAGTGGGCAGCTGG - Intergenic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic
1202162292 Y:21948037-21948059 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202229064 Y:22638336-22638358 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic
1202314090 Y:23557829-23557851 AAGTGTGGCCAAAGAGAAGCAGG + Intergenic
1202556712 Y:26112766-26112788 AAGTGTGGCCAAAGAGAAGCAGG - Intergenic