ID: 1039216934

View in Genome Browser
Species Human (GRCh38)
Location 8:35282402-35282424
Sequence AAGGGTATTAAGAAGGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039216934_1039216939 -1 Left 1039216934 8:35282402-35282424 CCATGACCCTTCTTAATACCCTT 0: 1
1: 0
2: 0
3: 16
4: 178
Right 1039216939 8:35282424-35282446 TTTGTAATTACTTCTATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039216934 Original CRISPR AAGGGTATTAAGAAGGGTCA TGG (reversed) Intronic
904493938 1:30876527-30876549 GAGGGTGTTGAGAAGGGACAGGG - Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
906854520 1:49290537-49290559 AATTGTATTAAGAAGGGGAAAGG + Intronic
907494663 1:54835942-54835964 AAGGGCAGGAAGATGGGTCATGG - Intronic
909427771 1:75546788-75546810 AAGGGTCTTCAGAAGGTTCATGG + Intronic
909994579 1:82263496-82263518 CAGGGGCTTAAGAAGGATCAGGG - Intergenic
913281350 1:117187988-117188010 AAGGGTATTAAAAGGGCCCAGGG + Intronic
913480608 1:119285678-119285700 AAGGGGATTATGGAGGGTGAGGG - Intergenic
914452778 1:147807412-147807434 AAAGGTTTTGATAAGGGTCAGGG + Intergenic
915901743 1:159851731-159851753 AAGGATGCTAAGAATGGTCAGGG + Intronic
916433583 1:164755921-164755943 CAGGGTTTTAAGAAGGCTCTGGG + Intronic
922527288 1:226314677-226314699 AGGGGTCTTAAGAAAGTTCATGG + Intergenic
922856746 1:228781565-228781587 AAGGAGATTAAGCAGGGTTAGGG - Intergenic
1063045704 10:2390407-2390429 AAGGGTATGAAGAAGTGAGAAGG - Intergenic
1063932495 10:11043253-11043275 GAGGGTATTAGGCAGGGCCAGGG + Intronic
1064448928 10:15424309-15424331 ATGTGTATTAAGAAGAATCATGG + Intergenic
1065089119 10:22211914-22211936 CATGGGATTAAGAAGGGACATGG - Intergenic
1067779312 10:49188071-49188093 AAGGAGAATAGGAAGGGTCATGG - Intronic
1074925857 10:118070075-118070097 AAGGGTATTAAAAGGGGGAAAGG - Intergenic
1079587823 11:22148091-22148113 AAGGGTATTAATAATGGTAAAGG - Intergenic
1081024000 11:37985660-37985682 AAGGGTCTTCAAAAAGGTCATGG - Intergenic
1081287911 11:41294775-41294797 AAGGGAATTAACAAGGATAAGGG + Intronic
1083248055 11:61445240-61445262 AAGGGTGTAGAGAAAGGTCAGGG + Intronic
1084865435 11:72052471-72052493 AAGGGTAATAAGTAAGGCCAGGG + Intronic
1088404940 11:109464471-109464493 TACGGAATTAAGAAGGGTAAGGG + Intergenic
1088599209 11:111460539-111460561 AAGGGTGTTAAGAAAGCTCAGGG + Intergenic
1089105715 11:116002171-116002193 AGTGGGATTAAGAAAGGTCAAGG + Intergenic
1089218720 11:116852859-116852881 AAGAGTATTAATAGGAGTCAGGG + Intronic
1089585335 11:119507037-119507059 AGGGGTATTTGGCAGGGTCATGG + Intergenic
1089637325 11:119823579-119823601 AAGGAAATTAAGAAGGCTCCAGG - Intergenic
1096765737 12:53887579-53887601 AAAGGTATTAAGAAGTTACATGG - Intergenic
1097403090 12:59153485-59153507 AAAGGTCCTAAGAAGGATCAAGG + Intergenic
1099993903 12:89755800-89755822 AATGGTATTAAGAACAGTTATGG - Intergenic
1109966445 13:69704275-69704297 TAAGGTAAAAAGAAGGGTCAAGG - Intronic
1110732692 13:78897539-78897561 AAGTGTATTAAGAACGGTCCTGG + Intergenic
1113174273 13:107544629-107544651 AAGGGTCCTGTGAAGGGTCATGG - Intronic
1113205487 13:107911304-107911326 AAGGGCAATAAGAAGAGTGAAGG - Intergenic
1119052629 14:71384946-71384968 AAAGGTATTGAGGAGAGTCAGGG + Intronic
1120165627 14:81195789-81195811 CGGGGTATTCACAAGGGTCAGGG - Intronic
1120306221 14:82773770-82773792 GAGAGTTTTCAGAAGGGTCATGG - Intergenic
1124381646 15:29172631-29172653 AAGGGCATTATGAAGGGCAAGGG - Intronic
1124897293 15:33788941-33788963 AAGGGGAATTAGGAGGGTCAGGG + Intronic
1125751182 15:42030147-42030169 AAGGGAATTAAGGAGGTTCATGG + Intronic
1125922070 15:43530876-43530898 AATGGTATAAAGCAGGGTCTGGG - Exonic
1126893152 15:53227979-53228001 AAGGGTCTTAGGAATGCTCAGGG - Intergenic
1128487945 15:68115020-68115042 AAGGGTACTTACAATGGTCATGG - Intronic
1130844004 15:87727134-87727156 AAGGGTCTTAATCTGGGTCATGG - Intergenic
1131044540 15:89303033-89303055 AAGGGAATAAAGAAGGTTGAAGG - Intronic
1131206781 15:90455782-90455804 AAGAGTCTTAAAAAGGTTCAAGG - Intronic
1131594441 15:93782500-93782522 AAGGGTATTAACACAGGTAATGG - Intergenic
1131787863 15:95932445-95932467 AAGGGTGTTAACAAGGCACAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1134662212 16:15992736-15992758 GAGTGCATTAAGCAGGGTCATGG - Intronic
1135644384 16:24148710-24148732 AAGTGTTTCAAGAAGGATCAGGG - Intronic
1137687896 16:50399567-50399589 GAGGGTATTAGGAAGGGTGGGGG + Intergenic
1138848050 16:60591363-60591385 AAGGCTTTTTAGGAGGGTCAGGG + Intergenic
1138911393 16:61403713-61403735 AAGGCTATTAAAACGGCTCAGGG + Intergenic
1140866552 16:79067404-79067426 AAAGTTTTTAAGAAAGGTCAAGG - Intronic
1142799586 17:2337124-2337146 ACGGGGATTCAGAGGGGTCACGG + Exonic
1142899342 17:3002669-3002691 AAGAGTATAAAGGAGGGACAGGG + Intronic
1143003528 17:3811301-3811323 CAGGTTCTTAGGAAGGGTCAGGG - Intergenic
1144074254 17:11702696-11702718 AAGAGGATGAAGAAGGTTCATGG + Intronic
1146984541 17:37202825-37202847 AAGGCTATTTAGAAAGGTAAGGG - Intronic
1147900609 17:43781267-43781289 ATGGGTATTTAGAAGGCTCTGGG - Intronic
1147988461 17:44319649-44319671 TAAGGAATTAACAAGGGTCAGGG + Exonic
1157867466 18:51198216-51198238 AAGGGCCTTAAGAAGAGTCACGG + Intronic
1158716979 18:59889258-59889280 AAGAGTTTTAAGAAGGGACCTGG + Intergenic
1158860224 18:61584417-61584439 TGGGGTATTAAGGAGGGTCTAGG - Intergenic
1163700598 19:18784828-18784850 AAGGGTTTTACGGAGGGTCATGG + Intronic
1164081409 19:21864793-21864815 AGGGGTATTTGGCAGGGTCATGG + Intergenic
927180581 2:20443980-20444002 AAGTGTATTATGAAGGGCAAGGG + Intergenic
927839211 2:26427712-26427734 AAGGGTAGTGTGGAGGGTCAGGG - Intronic
928478525 2:31656099-31656121 GAGGGAATCAAGAAGGGTGAAGG + Intergenic
928756688 2:34534878-34534900 AAAGGTTTTAAGAAGAGGCAGGG + Intergenic
929515695 2:42604631-42604653 AGGGGTATTTGGCAGGGTCATGG + Intronic
930166978 2:48212573-48212595 AAGAGAATTAAGAAGTGTGAAGG - Intergenic
930285097 2:49417871-49417893 AAGGGTATTAATAGGGTTTAGGG - Intergenic
930355090 2:50308270-50308292 AAAGGTAGTTAGCAGGGTCAGGG - Intronic
930543028 2:52731361-52731383 AATGGTATTAAGTATGCTCATGG - Intergenic
930720896 2:54636765-54636787 CAGGGTATTAAGATGGATAAAGG - Intronic
931752924 2:65346780-65346802 AAGGGTTGTGAGAGGGGTCAGGG - Intronic
933263442 2:80155202-80155224 AATGGTCTTAAGAAAGCTCAGGG + Intronic
934164919 2:89285260-89285282 TAGGGTTTCAGGAAGGGTCATGG + Intergenic
934202354 2:89897206-89897228 TAGGGTTTCAGGAAGGGTCATGG - Intergenic
934752893 2:96805495-96805517 AGGGGTATTTGGCAGGGTCATGG + Intronic
935262311 2:101365835-101365857 CAGGGTATTGTGAAAGGTCAAGG + Intronic
935521053 2:104105601-104105623 AAGAGTATTAAGTAGGGGAAAGG + Intergenic
937276984 2:120691221-120691243 AAGGGTGATAAGAAAAGTCATGG + Intergenic
937493295 2:122392393-122392415 AAGGGGATTATGGAGGGTGAGGG + Intergenic
940047068 2:149421073-149421095 GAGGGTATCAAAAAGGGCCAAGG - Intronic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
941721332 2:168816289-168816311 AAGCGTCTTAAACAGGGTCATGG - Intronic
941940984 2:171037138-171037160 TAGGGTATTAAGAAGCATGATGG + Intronic
942117220 2:172739772-172739794 AGGAGTATTATGAAGGGACAGGG + Intronic
944178142 2:196856749-196856771 AAGGTCACTAAGAAGGGTAAGGG - Intronic
1169649345 20:7849606-7849628 CAGGGCACTATGAAGGGTCATGG - Intergenic
1169834792 20:9866031-9866053 AAGGGTTTTAAGCAGGGTGTGGG + Intergenic
1174420544 20:50396512-50396534 AATGGCAGGAAGAAGGGTCAAGG - Intergenic
1174691560 20:52511499-52511521 AGGGGTCTAAAGAAGTGTCATGG + Intergenic
1175374148 20:58513466-58513488 AGGGGTCTGAAGGAGGGTCAGGG - Intronic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1177474474 21:21601888-21601910 CAGGGTATCAAGGAGTGTCATGG + Intergenic
1182900311 22:33892960-33892982 AAGGGGATTAAAAAGGGAGAAGG + Intronic
949118040 3:352752-352774 AAGCTTATAAAGAAGGGTTAAGG + Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
951052861 3:18114114-18114136 AAGGGTAGTGAGATGGGACAGGG - Intronic
951946987 3:28149554-28149576 ACGGAAATTAAGAAAGGTCATGG + Intergenic
952101944 3:30023966-30023988 AAAGTTATTAAGATGGCTCAGGG + Intergenic
957173400 3:76770492-76770514 GAGGGTATTACAAAGGGTCAGGG + Intronic
957552029 3:81718589-81718611 AGTGATATTAAGAATGGTCAAGG - Intronic
957766961 3:84637892-84637914 AAGGATAGTAAGGAGGGTCAGGG - Intergenic
959912780 3:111782606-111782628 AAGGGGAATAGGAAGGGCCAGGG - Intronic
962064062 3:131960808-131960830 AAGGGGATTATGGAGGGTAAAGG - Intronic
962818786 3:139026513-139026535 GAGGGGAGTTAGAAGGGTCAGGG - Intronic
965101843 3:164308951-164308973 ATGAGAATTAAGAGGGGTCAGGG - Intergenic
965237676 3:166147269-166147291 AAGCGTATTTGGAAGAGTCAAGG - Intergenic
965465810 3:169029434-169029456 AGGAGAATGAAGAAGGGTCAAGG - Intergenic
967603272 3:191414555-191414577 ATGAGTATTAGGAGGGGTCAAGG + Intergenic
968535492 4:1125228-1125250 AAAAGGATGAAGAAGGGTCAAGG + Intergenic
969096229 4:4734853-4734875 AAGGGTTTTGAGAACTGTCAAGG - Intergenic
969439803 4:7210269-7210291 AATGGTGATAATAAGGGTCAAGG - Intronic
971634357 4:29037273-29037295 AAGACTATGAAGAAGGGTCAAGG - Intergenic
973610940 4:52635520-52635542 AAGGCCAGTGAGAAGGGTCAAGG - Intronic
973679984 4:53307342-53307364 AAGGGTTTTAAGCGGGGGCATGG + Intronic
973726292 4:53780024-53780046 AAGTGTATCAAGAATAGTCATGG - Intronic
974359979 4:60865047-60865069 AAGGACAAGAAGAAGGGTCATGG - Intergenic
974480540 4:62437587-62437609 AAGGGGATTATGGAGGGTGAGGG + Intergenic
975405163 4:73980849-73980871 AAAGGTAATAATAATGGTCAAGG + Intergenic
975691958 4:76974224-76974246 AAAGGAATTAGGAAGAGTCACGG - Intronic
977238425 4:94537061-94537083 AAGAGTATTAACAGGGATCACGG - Intronic
977559976 4:98522393-98522415 ATAGCTATTAAGAAGGGTCCTGG - Intronic
979772821 4:124550633-124550655 AAGAGTACAAAGAAGGGTCTTGG - Intergenic
979814308 4:125080740-125080762 AAGGTTTGTAAGAAGGGACATGG - Intergenic
980675383 4:136072250-136072272 GAGGGTATTAAGTAGGGCTAGGG - Intergenic
981399197 4:144293028-144293050 AAGGGGGTTAAGAAGGCACAAGG + Intergenic
981523856 4:145693080-145693102 AGGGGTATTTGGCAGGGTCATGG + Intronic
981572323 4:146165807-146165829 AAGGGTAGAAAGAAAGGACATGG - Intergenic
982894260 4:160897218-160897240 CAGGGTGTTAAGTAGGGTCAAGG - Intergenic
984364799 4:178784829-178784851 ATGGGCTGTAAGAAGGGTCAAGG + Intergenic
987126802 5:14820721-14820743 AAGGTTAAGAAGAAGGCTCAGGG + Intronic
990197812 5:53338151-53338173 AAGGGGGTTCAGAATGGTCAAGG + Intergenic
991469766 5:66955390-66955412 AAGGGTAGTGAGGAGTGTCAGGG + Intronic
992978537 5:82141170-82141192 AGGGGTATTTGGCAGGGTCATGG - Intronic
994184005 5:96798712-96798734 ATGGGTATTAAGAAGGATGAGGG - Intronic
994216851 5:97147325-97147347 AATGGTAAGAAGAAGGCTCAGGG + Intronic
995569379 5:113463259-113463281 AAGGGTTGTAAGCAGGGGCAAGG + Intronic
995979871 5:118088441-118088463 AAGTGTTTTAAGAAGGGAAATGG - Intergenic
996109989 5:119554077-119554099 AAGGGTATTCAGGATGGGCACGG - Intronic
999040553 5:148405517-148405539 AAGGTTATCAAGAGGGGTCCTGG - Intronic
999283231 5:150378870-150378892 AAGGGAATTAAGGAGGGAGAAGG - Intronic
1001579841 5:172791081-172791103 AAGGGGATTATGAAGGTTCAAGG + Intergenic
1002275664 5:178103046-178103068 AAAGAAATTAAGAAGGGCCAGGG + Intergenic
1003225002 6:4195837-4195859 AAGGGTCTACAGAAGGTTCATGG + Intergenic
1003841289 6:10123116-10123138 ACAGATATTAAGAAGGGTGAAGG + Intronic
1003914241 6:10770925-10770947 AAGGGAACTAAGCAGGTTCACGG + Intronic
1003938618 6:11001767-11001789 AAGGGGATTAAGAATGGTCCAGG - Intronic
1007186731 6:39978112-39978134 CAGAGTAATAAGAGGGGTCAGGG - Intergenic
1008532715 6:52478996-52479018 GAGGATATTATGAAGGTTCATGG - Intronic
1011008703 6:82678606-82678628 AAGGGCATTCAGCAGGTTCACGG + Intergenic
1013056421 6:106587660-106587682 AAAGGTAGGAAGAAGGGTCTTGG - Exonic
1013827217 6:114228677-114228699 AAGGGTTTTAAAACAGGTCAGGG + Exonic
1015202987 6:130603470-130603492 AAGGGGAATAATAAGGGTTAGGG - Intergenic
1017425756 6:154319534-154319556 AAGGGAATTAAAAAGGGCCTGGG - Intronic
1018973792 6:168548200-168548222 AAGGGCATTCAGAAGGTCCAGGG - Intronic
1021032453 7:15754547-15754569 AAGGATAATAAGGAGGATCATGG - Intergenic
1021795060 7:24246278-24246300 AAGGGTTTTGAAAAGGGGCATGG - Intergenic
1024970855 7:55068860-55068882 ATGTGTAGAAAGAAGGGTCAGGG + Intronic
1025250437 7:57347973-57347995 AACGGCAGGAAGAAGGGTCAAGG + Intergenic
1027171839 7:75878361-75878383 AAGGGCATTGTGAAGGGTGAGGG + Intronic
1027828503 7:83148139-83148161 AAGGGTACTAAGAAAGGAAAGGG - Intronic
1028093365 7:86730459-86730481 AAAGCTATTAAGAAGTGTAAAGG + Intronic
1028995278 7:97093255-97093277 AAGTGTCTTCAGAAGGGTGAGGG + Intergenic
1029679192 7:102096276-102096298 AAGGGTGTTCAGAAGAGTCAGGG - Intronic
1030058489 7:105603721-105603743 AAGGGCTTTAAGGAGGGCCACGG - Intergenic
1036222496 8:6932346-6932368 AAGGCTTTTAAGAAATGTCAAGG + Intergenic
1037611304 8:20478439-20478461 AAGGGTTCTAAGAGGGGGCATGG + Intergenic
1037872826 8:22515109-22515131 AAGGGTAGTAAGAGGGGAAATGG - Intronic
1038053558 8:23836496-23836518 AATGGTATAAACAAAGGTCAAGG + Intergenic
1038825281 8:30992315-30992337 ATCTCTATTAAGAAGGGTCATGG + Intergenic
1039216934 8:35282402-35282424 AAGGGTATTAAGAAGGGTCATGG - Intronic
1040761633 8:50852659-50852681 AAGAGTGTTAAGAATGATCATGG - Intergenic
1042552721 8:70008508-70008530 AAGGATTTTAAGGAGGGGCAGGG + Intergenic
1045231071 8:100308551-100308573 ATGTGTATTAAGACGGGTAATGG + Intronic
1048522953 8:135173775-135173797 AAGTGTAATAAGAAGTGTAAAGG + Intergenic
1050425649 9:5509979-5510001 AAGGGTATTAAAAACTCTCAAGG + Intergenic
1050586987 9:7123323-7123345 AAGGGAATAAAGAAGGTTTATGG - Intergenic
1051532622 9:18121850-18121872 AAGAGTTTTAAGAATGGTGATGG - Intergenic
1056203844 9:84301404-84301426 AAGAGTGTTCAGAAGGGTCATGG + Intronic
1058628592 9:106961785-106961807 ATGTGTATCTAGAAGGGTCAAGG + Intronic
1060885860 9:127151566-127151588 AAGGGAAATAAAGAGGGTCAGGG + Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1187452530 X:19411588-19411610 AAGGGCATTAAGATAGGGCAGGG + Intronic
1187628648 X:21143966-21143988 AAGGGGATTATGAAGCTTCAAGG - Intergenic
1196707116 X:118726544-118726566 AAGGGTATTTATAAGGGAAAAGG + Intergenic