ID: 1039222657

View in Genome Browser
Species Human (GRCh38)
Location 8:35351876-35351898
Sequence GATATTGGCATGGATATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039222654_1039222657 23 Left 1039222654 8:35351830-35351852 CCTTTAATATTAACAAAGGGTTA 0: 1
1: 0
2: 0
3: 12
4: 219
Right 1039222657 8:35351876-35351898 GATATTGGCATGGATATAGAAGG No data
1039222652_1039222657 25 Left 1039222652 8:35351828-35351850 CCCCTTTAATATTAACAAAGGGT 0: 1
1: 1
2: 0
3: 10
4: 168
Right 1039222657 8:35351876-35351898 GATATTGGCATGGATATAGAAGG No data
1039222653_1039222657 24 Left 1039222653 8:35351829-35351851 CCCTTTAATATTAACAAAGGGTT 0: 1
1: 0
2: 1
3: 20
4: 244
Right 1039222657 8:35351876-35351898 GATATTGGCATGGATATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039222657 Original CRISPR GATATTGGCATGGATATAGA AGG Intronic
No off target data available for this crispr