ID: 1039229456

View in Genome Browser
Species Human (GRCh38)
Location 8:35427277-35427299
Sequence CTGAATGTTCACATGCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039229454_1039229456 -7 Left 1039229454 8:35427261-35427283 CCTCCTTTCTCTTCTACTGAATG 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1039229456 8:35427277-35427299 CTGAATGTTCACATGCACATAGG No data
1039229455_1039229456 -10 Left 1039229455 8:35427264-35427286 CCTTTCTCTTCTACTGAATGTTC 0: 1
1: 0
2: 2
3: 36
4: 335
Right 1039229456 8:35427277-35427299 CTGAATGTTCACATGCACATAGG No data
1039229453_1039229456 21 Left 1039229453 8:35427233-35427255 CCGGCTTTCACTTCTGCTGACAT 0: 1
1: 0
2: 1
3: 24
4: 293
Right 1039229456 8:35427277-35427299 CTGAATGTTCACATGCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039229456 Original CRISPR CTGAATGTTCACATGCACAT AGG Intronic
No off target data available for this crispr