ID: 1039234573

View in Genome Browser
Species Human (GRCh38)
Location 8:35487903-35487925
Sequence GTTTTCTAGTGGTTTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039234570_1039234573 12 Left 1039234570 8:35487868-35487890 CCTTGTTGTTAAACGGCAAAGGA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1039234573 8:35487903-35487925 GTTTTCTAGTGGTTTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039234573 Original CRISPR GTTTTCTAGTGGTTTGTGGA AGG Intronic
No off target data available for this crispr