ID: 1039234670

View in Genome Browser
Species Human (GRCh38)
Location 8:35488777-35488799
Sequence CTGGTTTCACAGATTGGCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039234666_1039234670 6 Left 1039234666 8:35488748-35488770 CCATTATATTTTGGAAGCAGATA 0: 3
1: 21
2: 110
3: 254
4: 783
Right 1039234670 8:35488777-35488799 CTGGTTTCACAGATTGGCGATGG No data
1039234665_1039234670 10 Left 1039234665 8:35488744-35488766 CCTACCATTATATTTTGGAAGCA 0: 8
1: 67
2: 142
3: 197
4: 359
Right 1039234670 8:35488777-35488799 CTGGTTTCACAGATTGGCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039234670 Original CRISPR CTGGTTTCACAGATTGGCGA TGG Intronic
No off target data available for this crispr