ID: 1039234670 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:35488777-35488799 |
| Sequence | CTGGTTTCACAGATTGGCGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039234666_1039234670 | 6 | Left | 1039234666 | 8:35488748-35488770 | CCATTATATTTTGGAAGCAGATA | 0: 3 1: 21 2: 110 3: 254 4: 783 |
||
| Right | 1039234670 | 8:35488777-35488799 | CTGGTTTCACAGATTGGCGATGG | No data | ||||
| 1039234665_1039234670 | 10 | Left | 1039234665 | 8:35488744-35488766 | CCTACCATTATATTTTGGAAGCA | 0: 8 1: 67 2: 142 3: 197 4: 359 |
||
| Right | 1039234670 | 8:35488777-35488799 | CTGGTTTCACAGATTGGCGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039234670 | Original CRISPR | CTGGTTTCACAGATTGGCGA TGG | Intronic | ||
| No off target data available for this crispr | |||||