ID: 1039235517

View in Genome Browser
Species Human (GRCh38)
Location 8:35498272-35498294
Sequence CTGTGTTGCTTGGAGTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039235513_1039235517 -1 Left 1039235513 8:35498250-35498272 CCATTTTTGACCTGGGTGGGAGC 0: 1
1: 0
2: 2
3: 17
4: 142
Right 1039235517 8:35498272-35498294 CTGTGTTGCTTGGAGTAGGTTGG No data
1039235508_1039235517 23 Left 1039235508 8:35498226-35498248 CCATTGGTATTATCATCTTGGAT 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1039235517 8:35498272-35498294 CTGTGTTGCTTGGAGTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039235517 Original CRISPR CTGTGTTGCTTGGAGTAGGT TGG Intronic
No off target data available for this crispr