ID: 1039237812

View in Genome Browser
Species Human (GRCh38)
Location 8:35522070-35522092
Sequence ATGTTTGTTGATGGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039237812_1039237821 25 Left 1039237812 8:35522070-35522092 CCATGCTCCCCATCAACAAACAT 0: 1
1: 0
2: 4
3: 16
4: 213
Right 1039237821 8:35522118-35522140 TACTATCTTCATAAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039237812 Original CRISPR ATGTTTGTTGATGGGGAGCA TGG (reversed) Intronic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
901637713 1:10678046-10678068 ATGTGTGTTGATGGGGAGACAGG + Intronic
905435571 1:37953038-37953060 GTGTTTGTTGGTGGGGGGGACGG - Intergenic
919667374 1:200304950-200304972 ATGGTTGTTTTTGGGGGGCAAGG - Intergenic
920056625 1:203197645-203197667 ATGGTTGTTTATGGTGAACAGGG - Intergenic
920704226 1:208240157-208240179 AAGTTCTTTGTTGGGGAGCAGGG - Intronic
921560537 1:216653194-216653216 AAGTTTGTTGATGTGAAGGATGG - Intronic
1065649220 10:27869892-27869914 ATGTTTGATGATGTGGGGAAGGG + Intronic
1069725949 10:70578679-70578701 AGGTTTGTTGATGGTGAGGTGGG - Intergenic
1070832562 10:79428340-79428362 ATGGTGGTTGCTGGGGGGCAGGG + Intronic
1070911487 10:80122642-80122664 ATCTTTGTTGATGAGGCTCAGGG + Intergenic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1073626577 10:105103689-105103711 ATGACTGTTGATGGGGCGAATGG + Intronic
1073783781 10:106866201-106866223 TTGTTTGTTGGAGGGTAGCAAGG - Intronic
1073994699 10:109301967-109301989 ATGTTGGTTTATGGGGACCTTGG - Intergenic
1074399139 10:113127302-113127324 ATATTTGGGGATGGGGAGGAGGG - Intronic
1075925050 10:126244973-126244995 ATGTTTGAAGATGGGGAGTAGGG + Intronic
1077465678 11:2732736-2732758 ATGTTTGTTCAAGGGAAGCCAGG - Intronic
1077639207 11:3866005-3866027 TTGTTTTCTGCTGGGGAGCATGG + Intronic
1077941372 11:6847144-6847166 ATGTTTGTTGATATTTAGCATGG + Intergenic
1078127390 11:8581125-8581147 ATGTGAGTTGATGGGAAGGAAGG - Intronic
1078445450 11:11401411-11401433 AGGTTTGGTGCTGGGCAGCATGG + Intronic
1078838686 11:15057183-15057205 ATGAAGGTTGAAGGGGAGCAGGG - Intronic
1080409967 11:32014177-32014199 ATGTTTGGTGATGAAGAGAATGG - Intronic
1081201233 11:40218497-40218519 ATCTTTGTTGATGCGGAGGCTGG - Intronic
1083926566 11:65810759-65810781 ATGGTGGATGATGGGGAGGAAGG + Intergenic
1084446794 11:69208572-69208594 ATGATTATTGTTGGAGAGCATGG - Intergenic
1088625500 11:111727501-111727523 CTGCATTTTGATGGGGAGCAAGG + Exonic
1089610782 11:119667352-119667374 ATGTTTGCTGATGGGAGGGATGG - Intronic
1089665565 11:120016103-120016125 ATGTGTGCTGATGGGATGCAGGG + Intergenic
1089699325 11:120235014-120235036 CTGGTCTTTGATGGGGAGCAGGG + Intergenic
1089966313 11:122656771-122656793 GTGTTCATTGATGGGGAGGATGG + Intronic
1090007648 11:123017215-123017237 ATGGTTGGGGATGGGGAGGAGGG - Intergenic
1090329806 11:125922257-125922279 ATGGATGTGGCTGGGGAGCAGGG + Intronic
1091000141 11:131904158-131904180 TTGTTTTTGGATGGGGAACAAGG + Intronic
1092232366 12:6783259-6783281 GGGTTTGAGGATGGGGAGCAGGG - Intergenic
1097685726 12:62689179-62689201 ATGTTTGGAGTTGGGGAGAAAGG + Intronic
1098439318 12:70501324-70501346 CTGTTGGGGGATGGGGAGCAAGG - Intergenic
1098747902 12:74264044-74264066 ATGTTTGTTTCTGGGGAACCTGG - Intergenic
1099246959 12:80203480-80203502 ATCTTTGTTGAGGGGGTGGAGGG + Intergenic
1100667358 12:96769422-96769444 GTGTGGGTGGATGGGGAGCAGGG + Intronic
1100863787 12:98834075-98834097 ATGTCTGTTGATGATGAGGAGGG + Intronic
1100926675 12:99556399-99556421 ATTTTTTTTGGGGGGGAGCATGG + Intronic
1103105865 12:118224326-118224348 ATGATCGTTGTTGGGGAGAAGGG - Intronic
1104151862 12:126091531-126091553 TTTTTTGTTGGTGGGGAGAAAGG - Intergenic
1104561888 12:129853261-129853283 ATGTTTCTAGATGAGGAGAATGG + Intronic
1105250231 13:18692590-18692612 ATGTTTATTAAAAGGGAGCATGG - Intergenic
1106765710 13:32911651-32911673 CTGTCTGTTGATGGGCAGAAAGG + Intergenic
1106817013 13:33419489-33419511 TTGATTGGTGATGGGGAGAATGG + Intergenic
1107991499 13:45822733-45822755 ATGTTTGCTGTTTGGGAGCTGGG + Intronic
1108191690 13:47947672-47947694 ATATTTGATTTTGGGGAGCAGGG - Intronic
1108334665 13:49427387-49427409 ATATTTGTTGCTGGGCACCATGG + Intronic
1108751668 13:53453592-53453614 ATGTTTGGTGGTGGTGAGAATGG + Intergenic
1111981518 13:95020999-95021021 TTTTTTTTTGATGGGGAGTAAGG + Exonic
1114712983 14:24797099-24797121 ATGTTTGTTGATCATGACCAAGG + Intergenic
1114899690 14:27041801-27041823 ATTTTTGTAGATGGTGATCAGGG - Intergenic
1115752631 14:36506690-36506712 ATGTCAGTAGATGGGGAGGAGGG - Intronic
1116621293 14:47207212-47207234 ATGATAGAGGATGGGGAGCAGGG + Intronic
1117720956 14:58628266-58628288 ATGTTTGTTGAATTGGAGGAAGG - Intergenic
1118934100 14:70270410-70270432 ATATTTTTTGAAGGGAAGCATGG - Intergenic
1119225451 14:72941495-72941517 GTGTATGTGGATGGGGAGCGTGG + Intronic
1121320189 14:92987590-92987612 ATGTTTGTTGTAAGGGAACAGGG + Intronic
1124947650 15:34284948-34284970 ATGTTTGATGAATGGCAGCAAGG + Intronic
1126859489 15:52870291-52870313 ATGTATGGTGATGGAGAGAAGGG + Intergenic
1127869471 15:63059088-63059110 ATTTTTGTTTATGGGTGGCAGGG + Intronic
1128110609 15:65073916-65073938 ATGCTTGTGGATGGGAAGAAGGG - Intronic
1128911864 15:71522958-71522980 ATGTGTGTTGATGTTGTGCAAGG - Intronic
1129464267 15:75715160-75715182 ATCTGTGTAGGTGGGGAGCAGGG - Intergenic
1129720982 15:77877852-77877874 ATCTGTGTAGGTGGGGAGCAGGG + Intergenic
1131175887 15:90209598-90209620 ATGTTTGATGATGATGAGGAGGG - Intronic
1131347076 15:91660165-91660187 GTGTTTGGTGATGGGGAGCAAGG - Intergenic
1131781635 15:95866009-95866031 ATCTTTGTTTATGGTGATCATGG - Intergenic
1131832333 15:96361645-96361667 GTGTGTGTTGAGGGGGAGCGGGG - Intergenic
1132171093 15:99656255-99656277 ATGTTAGTAGATGTGGAGGATGG - Intronic
1135903736 16:26491060-26491082 TTGTTTGTTGAGGGGATGCATGG - Intergenic
1137539520 16:49352677-49352699 ATGGTGGTTGCTGGGGAGGAGGG + Intergenic
1139388040 16:66586939-66586961 GTGTTTGTTGATGGGGACCCTGG + Intronic
1140132389 16:72174973-72174995 TTGTGTCTTGATGGGGAACAGGG - Intronic
1140138161 16:72226836-72226858 ATTTTTGCTGATGGAGATCAAGG - Intergenic
1143837007 17:9700744-9700766 AAGTATGGTGATGAGGAGCATGG - Intronic
1143849534 17:9799842-9799864 CTGTTTCTTGAGGTGGAGCACGG + Intronic
1144509829 17:15866488-15866510 TTGTTTGGTGGTGGGGAGCGGGG + Intergenic
1145173939 17:20684131-20684153 TTGTTTGGTGGTGGGGAGCGGGG + Intergenic
1147190140 17:38733646-38733668 ATGTTTGCTGATGGGGAAGATGG + Exonic
1148554481 17:48570143-48570165 TTGTTTGTTGATTGGAAGCTCGG - Intronic
1153474279 18:5481093-5481115 ATGCTTTGTGATGGAGAGCAGGG - Intronic
1154438614 18:14366333-14366355 ATGTTTATTAAAAGGGAGCATGG + Intergenic
1156175601 18:34541971-34541993 AAGTTTGTGCATGGGGAACAGGG + Intronic
1156610878 18:38722711-38722733 GAGTTTGTTGATGGGTAGCCTGG + Intergenic
1157303349 18:46497100-46497122 ATGTCTGTTGAAGGGGTGGAGGG + Intronic
1157600375 18:48889719-48889741 AGGTGGGTTGATGGGGAGCAGGG - Intergenic
1158090768 18:53710363-53710385 TTGTTTTTTGAGGGGGAGCATGG + Intergenic
1158206681 18:55000752-55000774 CTACTTGTGGATGGGGAGCATGG - Intergenic
1159467973 18:68810837-68810859 CTGTTGGGTGGTGGGGAGCAAGG - Intronic
1164962664 19:32448292-32448314 ATGAATGGTGATGAGGAGCATGG + Intronic
1165255697 19:34576337-34576359 ATGACTGGGGATGGGGAGCAAGG + Intergenic
1166920902 19:46228567-46228589 ATCTGTGTTCCTGGGGAGCACGG - Intergenic
1168387687 19:55979441-55979463 ATGTTGGTTTTTGCGGAGCATGG - Exonic
925762702 2:7201190-7201212 ATGATTCTTGATGAGGAGCTGGG + Intergenic
925959393 2:9001940-9001962 TTCTTTGCTGATGAGGAGCAAGG - Intronic
926087325 2:10028638-10028660 ATGTGTGTTGGAGGGGAGGAGGG - Intergenic
926291034 2:11530659-11530681 ATGTGAGTTAATGGGGGGCAGGG + Intergenic
929168899 2:38911490-38911512 ATGTGTGTATATGGGGAGGAGGG + Intronic
930393704 2:50793411-50793433 ATGTTTAGTGAAGGGAAGCAGGG + Intronic
930973793 2:57429753-57429775 ATGTTTCTTAATGTGGAGAAAGG + Intergenic
931091402 2:58890572-58890594 CTGTTGGTGGATGGGGGGCAAGG - Intergenic
931234614 2:60402699-60402721 ATGTGTGTGTATGTGGAGCAGGG - Intergenic
931932814 2:67160209-67160231 ATGTTTTTTGATGGAGAGACAGG + Intergenic
932771965 2:74505512-74505534 AGGTTTCTTGAGGGGGAGAAGGG - Intronic
934970734 2:98762078-98762100 AGTTATGCTGATGGGGAGCAAGG + Intergenic
935332971 2:101990712-101990734 ACATTTGAGGATGGGGAGCAAGG - Intergenic
936558124 2:113513632-113513654 AAGTATGTTCATAGGGAGCATGG + Intergenic
937997246 2:127703591-127703613 TTGTTTACTGATGGGGAACAAGG - Exonic
938259996 2:129888669-129888691 ATGGTTGGTGATGGTGTGCATGG + Intergenic
939089747 2:137765806-137765828 ATGTTTGTAGTCAGGGAGCATGG + Intergenic
940442781 2:153738315-153738337 ATGTTGGGACATGGGGAGCACGG - Intergenic
941620138 2:167768298-167768320 ATTTTTGTTGTTGGGAAGCATGG - Intergenic
943241450 2:185389742-185389764 ATGTTTGAGTATGGGAAGCAGGG - Intergenic
943526724 2:189025650-189025672 AGGTTTGTACATGGGAAGCATGG - Intergenic
945103738 2:206288808-206288830 AGGTTTGATCCTGGGGAGCAGGG + Intronic
945384705 2:209183265-209183287 TTGTGTGTTGGTGGGGAGAAGGG - Intergenic
946089613 2:217209116-217209138 GTGCCTGTTGATAGGGAGCAGGG - Intergenic
947762511 2:232613102-232613124 ATATTTTTTGGTGGGGGGCAGGG - Intronic
1169627675 20:7590826-7590848 ATGTATGTGGATGGGGGACAGGG - Intergenic
1172125804 20:32624599-32624621 ATGCTTGGTGAAGGGGAGGAAGG - Intergenic
1174466037 20:50718174-50718196 AAGTGGGGTGATGGGGAGCAAGG - Intergenic
1174814918 20:53678499-53678521 TTATTTGGGGATGGGGAGCAAGG - Intergenic
1176457068 21:6923146-6923168 ATGTTTATTAAAAGGGAGCATGG - Intergenic
1176835241 21:13788228-13788250 ATGTTTATTAAAAGGGAGCATGG - Intergenic
1178453444 21:32726573-32726595 GTTTTTGTTGAGGGGGTGCAGGG - Intronic
1179992649 21:44956662-44956684 AGGCTTGTTGATGGCGTGCACGG + Intronic
1181902996 22:26170512-26170534 GTGTTTGTTGAAGGGGAAGAGGG + Intronic
1184944253 22:47791103-47791125 GTGTTTGGTGCTGGGGAGAAAGG - Intergenic
949242258 3:1887066-1887088 ATGTTTATTCAGGGTGAGCACGG - Intergenic
950356020 3:12409962-12409984 AAGTTGGTAGAAGGGGAGCAGGG - Intronic
951604865 3:24421976-24421998 ATTCTTGTTGATGGGGAAAAAGG - Intronic
952311418 3:32193842-32193864 ATGAGTGCTGATGGGGAGAAGGG - Intergenic
953546234 3:43865524-43865546 AAGCTTGTTGCTGGGGAGGATGG + Intergenic
954592941 3:51799549-51799571 ATGTTTTTTGTTGGGGAGGGAGG + Intergenic
954795055 3:53157129-53157151 ATGTGTGTAGGTGGGGAGAAGGG - Intronic
956019762 3:64921680-64921702 CTTTTTGTGGATGGGGAGGACGG + Intergenic
958016459 3:87944239-87944261 ATGCATCTTGATGGGGAGCTGGG - Intergenic
958271565 3:91506238-91506260 ATGTGTGTGGGTGGGGAGCGGGG + Intergenic
959580742 3:107980064-107980086 AAGTTTGTTTTGGGGGAGCAGGG - Intergenic
960371478 3:116846324-116846346 CTGCTTGTTGATGTGGAGGAGGG + Intronic
961077773 3:123997743-123997765 GTGTGTGATGGTGGGGAGCAAGG - Intergenic
962456273 3:135568217-135568239 AGGTTTATTGATGGGGAGGGAGG + Intergenic
962845985 3:139274284-139274306 ATGCTGGGTGATGGGGTGCAGGG - Intronic
962969761 3:140388313-140388335 ATGGCTATTGATGGAGAGCATGG + Intronic
965406029 3:168270132-168270154 ATGTCTGTTAATTTGGAGCAAGG - Intergenic
966317993 3:178670242-178670264 TTTTTTGTTGGTGGGAAGCAGGG + Intronic
966627074 3:182029039-182029061 ATGTTTGTTGTTGGGGCTGAAGG + Intergenic
968580767 4:1393064-1393086 ACGTGTGTTGATGTGGAGCTGGG + Exonic
969335999 4:6510685-6510707 ATGTTTGTTGAGGCCGGGCACGG + Intronic
970275400 4:14394289-14394311 ATGTTTGTTGATTGATTGCATGG + Intergenic
971202280 4:24521601-24521623 CTGGTTGATGATGGGTAGCAGGG - Intronic
972930029 4:44061037-44061059 ATTCCTTTTGATGGGGAGCATGG + Intergenic
975424400 4:74209339-74209361 CTGTTGGGTGGTGGGGAGCAAGG - Intronic
977676659 4:99755619-99755641 ATGTTTTTTGTGGGGGAGGAGGG + Intergenic
978337767 4:107688208-107688230 TTGTTTGTTGCTGGGGAGCAGGG - Intronic
981106547 4:140888186-140888208 ATGTTGGGGGATGGGGAGGAGGG + Intronic
981354636 4:143774339-143774361 GTGCCTGGTGATGGGGAGCATGG + Intergenic
981931606 4:150195735-150195757 GTTTTTGTTGATGGTGAACAGGG + Intronic
982276692 4:153642865-153642887 ATGTTTTTTGAAGCTGAGCAAGG + Intergenic
983770797 4:171546395-171546417 AGGTTTGATGATGGGAAGTAGGG + Intergenic
985401050 4:189594411-189594433 ATGCTTGTGGATAGGCAGCAAGG - Intergenic
986676442 5:10189627-10189649 AAGTTTGATGATGTGGAGTAGGG - Intergenic
986895583 5:12362537-12362559 AGGTTTGCTGCTGGGGAGTAGGG - Intergenic
989695271 5:44192647-44192669 ATGTTTATTGATGGTGAGCTTGG - Intergenic
989988250 5:50728927-50728949 ATGTTTGTTGATGTTGAAAAAGG + Intronic
993465848 5:88245745-88245767 ATGTTTGGTGATTTGGAGGAAGG - Intronic
993695789 5:91060181-91060203 TTGTTTGTTGCTGGGGGGCGGGG + Intronic
994412242 5:99421009-99421031 ATGATTGATGGTGGGGAGCATGG + Intergenic
994481578 5:100344244-100344266 ATGATTGATGGTGGGGAGCATGG - Intergenic
996411148 5:123161023-123161045 ATGTTAGTAGATGGGGAGGCTGG - Intronic
997306499 5:132840907-132840929 ATGTGTGTTGGTGGGGGGTATGG + Intergenic
997354993 5:133256620-133256642 ATGTTTGTGGATGGGAGGCTGGG + Intronic
997836552 5:137198887-137198909 ATGTATTTTGGTGGGTAGCATGG + Intronic
997865000 5:137453968-137453990 ATGTTTGTCCTTAGGGAGCATGG - Intronic
999154397 5:149448077-149448099 ATCTTTGTGGAAGGGGAGAACGG - Intergenic
1000348457 5:160333723-160333745 GGGTGTGGTGATGGGGAGCAGGG - Intronic
1001197808 5:169689359-169689381 ATTTTTGTGGTTGGGGAGCACGG - Intronic
1001681123 5:173557620-173557642 ATGTGTGTGTATGGGGGGCAGGG + Intergenic
1003964181 6:11237244-11237266 ATGTGTGTTCTTGGGGAACAGGG + Intronic
1004062896 6:12215479-12215501 ATGTGTGTTGGTGGCGAGGAGGG - Intergenic
1007148770 6:39666688-39666710 ATGTTTTTTGAAGGCAAGCATGG + Intronic
1007176728 6:39902321-39902343 ATGGTAGGGGATGGGGAGCAGGG - Exonic
1007282761 6:40724391-40724413 ATGATTGTTCATGGAGAGGATGG - Intergenic
1007838984 6:44700407-44700429 ATCTCTGTTCATAGGGAGCAAGG - Intergenic
1009501734 6:64421943-64421965 ATGTTTCTTGATGGGGAGGATGG - Intronic
1010401827 6:75454886-75454908 ATGTTTGTTTTGAGGGAGCAGGG + Intronic
1011734778 6:90299316-90299338 ATGTGTGTTGATCCAGAGCATGG + Intergenic
1018153385 6:160961849-160961871 ATGTTTTTTGATGGGGAAGGGGG - Intergenic
1019703204 7:2484451-2484473 ATGTTTATGGATGAGGAGTAAGG - Intergenic
1022051023 7:26672079-26672101 ATGTCTGTCACTGGGGAGCAGGG - Intronic
1022542377 7:31149697-31149719 AAGCCTGTTGGTGGGGAGCAAGG + Intergenic
1022808795 7:33849021-33849043 ATGGTTGTTGAAGGGGTGCTGGG + Intergenic
1023544194 7:41300013-41300035 ATGCTTATTGAAGGTGAGCAGGG - Intergenic
1027476612 7:78639823-78639845 AAGTTTCTTGAGGGGGAGCCAGG - Intronic
1028840149 7:95420670-95420692 GTGTGTGTTGATGGGAATCAAGG + Intronic
1030589926 7:111468284-111468306 ATTTTAGTTGTTGGGAAGCAAGG - Intronic
1031023307 7:116651589-116651611 ATCCTTGTTGATGGTGAGGAAGG - Intergenic
1031466570 7:122119554-122119576 ATGTTTGTTGGGGGTGAGGATGG - Intronic
1031890254 7:127286139-127286161 CTGTTTGATGATGAGGAACAGGG - Intergenic
1035695561 8:1593096-1593118 GTGTTTGTTGAGGGGAAGGAGGG - Intronic
1038216317 8:25564791-25564813 AAGCTTCTTCATGGGGAGCAGGG + Intergenic
1039237812 8:35522070-35522092 ATGTTTGTTGATGGGGAGCATGG - Intronic
1043152178 8:76731372-76731394 AAGTTTGGAGATGGGGAGAAGGG + Intronic
1043831946 8:84999720-84999742 AGGTGTGTGGATGGGGAACATGG - Intergenic
1044316155 8:90751666-90751688 TTGTTTGGTGAGGAGGAGCAGGG + Intronic
1047848609 8:128831296-128831318 ATATTTCTTGCTGGGAAGCAAGG - Intergenic
1048270361 8:133023309-133023331 ATTTTTTTTGATGGGGAGCAGGG + Intronic
1048674393 8:136761778-136761800 CTGTCTGGAGATGGGGAGCAAGG - Intergenic
1048868649 8:138779552-138779574 TTGTTTGTTCAGGGGGAGCCAGG - Exonic
1052095680 9:24380917-24380939 ACGTTTGTTGATGAGGAGGATGG - Intergenic
1055275773 9:74613731-74613753 CTGCTTTTTGATGGGGAGAAAGG - Intronic
1056788796 9:89611935-89611957 TTGTTTGCTATTGGGGAGCACGG + Intergenic
1057556602 9:96093267-96093289 ATGTTTTCTCATGGTGAGCAAGG - Intergenic
1060019319 9:120115651-120115673 ATGTGTGCTGCTGGGGAGGATGG - Intergenic
1060255091 9:122020346-122020368 TTTGTTGGTGATGGGGAGCAGGG - Intronic
1060525812 9:124320689-124320711 ATGTTTGCTGCAGTGGAGCATGG - Intronic
1186732741 X:12427731-12427753 ATATTTGTGTCTGGGGAGCAGGG - Intronic
1187462268 X:19498280-19498302 ATGTTTATTGATGGGGGTCAAGG + Intronic
1187823994 X:23316809-23316831 ATGTTTATTAAAGGGCAGCATGG - Intergenic
1188255861 X:27961289-27961311 ATGTTTGGTGTTGGGGAGGGAGG - Intergenic
1189027861 X:37416673-37416695 TTGTTTGTTTCTTGGGAGCAAGG + Intronic
1193406984 X:81112957-81112979 ATGTTTGTTGATGGGCATTTGGG - Intergenic
1194794713 X:98197508-98197530 ATGTGTGTGGAGGGGGAGCATGG - Intergenic
1195405377 X:104507416-104507438 ATGTTTGTTTATTTGGAGCAGGG - Intergenic
1195500960 X:105598692-105598714 ATGTTTGGGTATGGGGAGAAAGG - Intronic
1196894199 X:120318483-120318505 ATGTTTTTTGATGGGGATAAGGG - Intergenic
1197041629 X:121943493-121943515 TTGTTTTTTGGTGGGGGGCAGGG - Intergenic
1197563053 X:128047789-128047811 ATGTTTGGTGAGGAGCAGCAGGG + Intergenic
1200288995 X:154853830-154853852 GTTTTTGTTGATGGGGAGGCTGG + Intronic