ID: 1039242836

View in Genome Browser
Species Human (GRCh38)
Location 8:35575372-35575394
Sequence CAGATGCCATGTTAGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039242836_1039242838 16 Left 1039242836 8:35575372-35575394 CCATGGATCTAACATGGCATCTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1039242838 8:35575411-35575433 ATAGCTTACATTGACAGATAAGG No data
1039242836_1039242839 17 Left 1039242836 8:35575372-35575394 CCATGGATCTAACATGGCATCTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1039242839 8:35575412-35575434 TAGCTTACATTGACAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039242836 Original CRISPR CAGATGCCATGTTAGATCCA TGG (reversed) Intronic
901927159 1:12573488-12573510 CAGATGCTGTGCTAGATGCAGGG - Intronic
903383110 1:22910180-22910202 CAGCTGCCATGTCAGATTGAGGG + Intronic
904663094 1:32099694-32099716 CAGAGGCCATGTCAAATCCTTGG + Intronic
906456328 1:46000406-46000428 CAGCTGCCATGTTAGGTGCGAGG + Intronic
908651940 1:66343363-66343385 CTGATGACATGTTTGAGCCAAGG - Intronic
909024346 1:70465078-70465100 AAGATGGGAAGTTAGATCCATGG - Intergenic
910749558 1:90614071-90614093 CAGAGGCCATGATACTTCCATGG - Intergenic
911678744 1:100690394-100690416 CAGAAGCCATGTAAGATAGAAGG - Intergenic
912575591 1:110669041-110669063 CAGATGCCCTTAAAGATCCATGG + Intergenic
917816376 1:178713829-178713851 AAGATGCCATGTTCAATTCAAGG + Intergenic
919718420 1:200805385-200805407 CAGATACCACGTTAGATGTAGGG + Intronic
920756343 1:208737640-208737662 CAGATTACATGTTATATTCAGGG - Intergenic
922153069 1:223021481-223021503 CAGAGGCCAGGTCAGAACCAGGG - Intergenic
1063366781 10:5495621-5495643 CAGGTGCCATGCTAGCTCCATGG + Intergenic
1064030783 10:11881274-11881296 CAGATGCCATGCTAGGTACTGGG - Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1067824740 10:49562578-49562600 CAGAAGCCATATTATATCCTTGG - Intergenic
1070282270 10:75058505-75058527 CAGATGTCATTTTAGAGCCAAGG + Exonic
1071393677 10:85200410-85200432 CTGATGCTTTTTTAGATCCAGGG - Intergenic
1072626389 10:97115106-97115128 CAGAGGCCATGTGAGCTTCAAGG + Intronic
1074136437 10:110631270-110631292 CATATGCTGTGTTATATCCAGGG + Intergenic
1074142692 10:110688852-110688874 TAAATGCCATGTTGGATCCTGGG - Intronic
1079854799 11:25589132-25589154 AAAATGCCATGTTAAATCAAAGG + Intergenic
1084417655 11:69042761-69042783 CAGAAGCCATCCTAGAACCAGGG - Intergenic
1085755954 11:79201576-79201598 CAGAAGCTCTGTTAGATGCAGGG + Intronic
1086123892 11:83329761-83329783 CAGAAACCATTTTAGATACAGGG - Intergenic
1086257627 11:84897515-84897537 CAGATACCAGGATAGATTCATGG - Intronic
1086599615 11:88616936-88616958 CAGGTGCTATGCTAGATACAAGG - Intronic
1090424291 11:126596252-126596274 CAGGTGCTGTGTTAGATCTAAGG - Intronic
1090491256 11:127162773-127162795 CAGGTGCCATGTTATATACGAGG + Intergenic
1091262225 11:134243820-134243842 CAGATGTAATGTTAGCTCCCTGG - Intronic
1095260078 12:40087614-40087636 CAGAGGCTATGATAGATCCTGGG + Intronic
1098341385 12:69455252-69455274 CAGACACCATGCTAAATCCATGG + Intergenic
1098782406 12:74703635-74703657 CAAAGGCAATGTTAGATCCTAGG + Intergenic
1101229780 12:102728569-102728591 CAGATGTTATGTTAGATCAGAGG + Intergenic
1102693618 12:114781074-114781096 CAGATGCCATTTTGAATCCAAGG + Intergenic
1105063122 12:133172312-133172334 CTGCTCCCAAGTTAGATCCAGGG - Intronic
1105559020 13:21473201-21473223 GAGATGCCATCTAAGAGCCAAGG + Intergenic
1106759257 13:32851564-32851586 CAGATACTATGTTAGCTTCAGGG + Intergenic
1107408487 13:40137413-40137435 CAAATGCCATGATTGATTCAGGG - Intergenic
1108348432 13:49568514-49568536 CAGGTGCCATCCTACATCCATGG - Intronic
1110657057 13:78012450-78012472 CAGACACCATGCTAGATCCTAGG - Intergenic
1110739067 13:78973128-78973150 CAGATGCCTTGTGAAGTCCAGGG + Intergenic
1112299288 13:98215650-98215672 CAGGTGCCATGCTAGATGCTGGG - Intronic
1115358003 14:32470047-32470069 ATGATGTCATATTAGATCCAGGG + Intronic
1115864498 14:37729435-37729457 CAAATGCCATGTTAGGTCTGCGG - Intronic
1119058433 14:71448138-71448160 CAGCTGCCATGTAATAGCCAAGG - Intronic
1119122912 14:72096626-72096648 CAGCTGCCATTTAAGAGCCAGGG - Intronic
1119750438 14:77073650-77073672 CAGATGCCATATTAGAGACTGGG - Intergenic
1121428192 14:93868368-93868390 CAGATGACATGTAGGTTCCAGGG - Intergenic
1128564230 15:68689300-68689322 CAGATGGCAGGTTAGAGCCCTGG + Intronic
1130243346 15:82219335-82219357 CAGATGTCATGCTGGAGCCAGGG - Intronic
1130457123 15:84121971-84121993 CAGATGTCATGCTGGAGCCAGGG + Intergenic
1130627738 15:85533315-85533337 CAGATACCATGTTATAGGCATGG + Intronic
1131541150 15:93276470-93276492 TAAATGCGATGTGAGATCCAGGG - Intergenic
1133749759 16:8715277-8715299 CAAATGCAATGTTTGATCCTAGG + Intronic
1134790952 16:16988848-16988870 CAGATGCTATGTTAGAGTCTGGG + Intergenic
1135673614 16:24395414-24395436 CAGATGAGATCTGAGATCCAAGG + Intergenic
1138029459 16:53548482-53548504 CAGATGCGATGTTAAATTCTAGG + Intergenic
1139344645 16:66294693-66294715 CACATGCCAACTTAGATCCAAGG - Intergenic
1141195692 16:81859290-81859312 CGGATGCCATGTTGGGTCCTGGG + Intronic
1145276642 17:21435368-21435390 CTGATGCCATGCTAGAGACATGG + Intergenic
1145314482 17:21721256-21721278 CTGATGCCATGCTAGAGACATGG + Intergenic
1149488477 17:57064354-57064376 CAGTTAACATGTTAGATACAAGG - Intergenic
1150231496 17:63554433-63554455 CAGATGCCAAGGCAGCTCCAGGG - Intronic
1151696338 17:75720050-75720072 CAAATGCCATGTAAAAGCCATGG + Intergenic
1153794697 18:8610639-8610661 CAGTTTCCATTTCAGATCCACGG - Intronic
1153924691 18:9825680-9825702 CAGATGCCAGGATAGATTCTGGG - Intronic
1154026833 18:10715921-10715943 CACATGCCTTATTAGATGCACGG - Intronic
1155857829 18:30855867-30855889 CAGATCCCATGAAAGCTCCAAGG - Intergenic
1157709957 18:49843412-49843434 CAAATGGCAAGTTAGATCTATGG + Intronic
1167009181 19:46795598-46795620 CAGCTGCTAAGTGAGATCCAAGG - Intergenic
925373850 2:3367729-3367751 CAAATGCCTTTTTATATCCATGG - Intronic
925774988 2:7326351-7326373 CAGGTGCCAAGCTGGATCCATGG - Intergenic
926242514 2:11099589-11099611 CAGCTGCCATGTCAGTGCCAGGG - Intergenic
926627288 2:15102872-15102894 CAGATGCCAAGGTAGATAAAAGG - Intergenic
927194473 2:20538245-20538267 CAAATGCCAGGAAAGATCCACGG - Intergenic
928267678 2:29825333-29825355 CAGATTCCCTGTTAGGTCCTGGG + Intronic
929568964 2:43007771-43007793 CAGATGCACAGTTAGCTCCATGG + Intergenic
929879404 2:45823036-45823058 CAGGTGCCATGCTAGGCCCAGGG + Intronic
933451210 2:82454510-82454532 CTGATGCCATGTTAGCCACATGG + Intergenic
936844674 2:116816401-116816423 CAGATGCTATGAGAGAGCCAGGG - Intergenic
937071642 2:119067907-119067929 CAGGTGCCAGGTCAGATTCATGG + Intergenic
938689559 2:133775090-133775112 CAGATGCTGTGTGAAATCCAGGG - Intergenic
939483438 2:142778624-142778646 CAAATGCCATCTAAGAGCCAAGG + Intergenic
940966695 2:159846188-159846210 CTGATAGCATGTTACATCCATGG - Intronic
947619867 2:231582943-231582965 CAGCTGCCCTCTTAGAACCACGG - Intergenic
947687116 2:232097677-232097699 GTGATGCCATGTAAGAGCCAAGG + Intronic
947698347 2:232211563-232211585 CAAAGGCCATGTTAGTGCCAAGG - Intronic
948037712 2:234872780-234872802 CAGATGCCCTTTGAGAACCAAGG - Intergenic
1169211064 20:3766637-3766659 CAGAGGCCAGGCTGGATCCAGGG + Intronic
1170918815 20:20655926-20655948 CAGATGCAATCTTAGACCCGAGG + Intronic
1172124158 20:32615193-32615215 CAGATGCTATGCTAGGTACAGGG - Intergenic
1174531651 20:51219269-51219291 CAGTTGCCAGGTGAGATGCAAGG + Intergenic
1175482573 20:59321845-59321867 CAGACTCCATGTTTGACCCAGGG + Intronic
1183923963 22:41192379-41192401 TAAATGCCATGTTACATTCACGG + Intergenic
949103648 3:177439-177461 AAGTTGCCATGTAAGTTCCAAGG + Intergenic
959227252 3:103601804-103601826 CAGATGTCATGTCAGAAACATGG - Intergenic
960241727 3:115350481-115350503 CAGAGGCAATGTTATATCCTTGG + Intergenic
960284217 3:115809358-115809380 CTGATGCCATGTGACAGCCATGG + Exonic
961141086 3:124557082-124557104 CAACTTCCATGTTAGATTCAAGG + Intronic
962088834 3:132221455-132221477 CAGATGTCTAGTTAGATTCAGGG - Intronic
962091082 3:132245076-132245098 CAGATGCCATGTTAACACCAAGG - Intronic
964515888 3:157507137-157507159 AAGAGGCCATGTTAGAGGCAGGG - Intronic
970100565 4:12516358-12516380 CAGATCACAGGCTAGATCCAAGG + Intergenic
972932366 4:44088642-44088664 CAGATGCCATGTTAGATTATGGG - Intergenic
974041948 4:56865022-56865044 CAGGTGCATAGTTAGATCCATGG + Intergenic
974224196 4:59018049-59018071 GAGATGCCATCTGGGATCCAGGG + Intergenic
978112484 4:104979082-104979104 GAGATGCCATGTGAGAGCCAGGG - Intergenic
978650942 4:111004075-111004097 CAGATATCATGTTGGATCCCAGG + Intergenic
980649751 4:135696919-135696941 CAGATGCCATGTTAGAGGAGAGG + Intergenic
981416762 4:144502924-144502946 CAGATGCCATGCTGAAGCCAAGG - Intergenic
984843790 4:184093000-184093022 CACATAGTATGTTAGATCCAGGG + Intronic
992433465 5:76732326-76732348 CAAATGCCACCTTAGATCCCCGG + Exonic
995544129 5:113213396-113213418 TAGATGCCATGTGAAATGCAAGG + Intronic
996148705 5:120008540-120008562 CAGGTGGCATGTTAAGTCCATGG + Intergenic
997596475 5:135110524-135110546 CAGATGCCCTGTCAGAGCCTAGG + Intronic
999385498 5:151151243-151151265 CAGAAGCCATCTTAAAGCCAGGG - Intronic
1000261943 5:159596545-159596567 CAGAGGCCAAGTGAGATCAAGGG - Intergenic
1001940430 5:175736142-175736164 CAGCTGCCATCTGAGATCCAGGG + Intergenic
1008063592 6:47024633-47024655 CAGATTCCATGTGAGAGCTAAGG - Intronic
1009322083 6:62304261-62304283 GAGATGACAAGTTAGATCAATGG + Intergenic
1010120346 6:72368714-72368736 CAGATGACAAGTTAGATAAAAGG + Intronic
1011386216 6:86801510-86801532 CAGATGCCATCTAGGAGCCAGGG + Intergenic
1012717769 6:102698870-102698892 GAAATGCCATCTAAGATCCATGG + Intergenic
1014141675 6:117950514-117950536 CAGCTGCCATGGAAGATCCTTGG + Intronic
1017347297 6:153398944-153398966 CAGAATCCATGTTAGATACTGGG + Intergenic
1018640380 6:165899039-165899061 CAGAGGCAATGTGAGTTCCATGG + Intronic
1020612440 7:10416419-10416441 CATGTCCCATGTTAGAACCAAGG + Intergenic
1022206485 7:28169116-28169138 AAGGTGCCATGATAGTTCCAGGG + Intronic
1022564679 7:31385883-31385905 GAGATGGCATGATAGATGCATGG + Intergenic
1023733693 7:43216578-43216600 CAGATGCCGTGTTAGCCCCAGGG + Intronic
1026070312 7:67112973-67112995 CATTTGCCATGTTAGAACCATGG + Intronic
1026479478 7:70765493-70765515 CAGATCTCATGTTAGACACAGGG + Intronic
1026560445 7:71444143-71444165 CAGATCCCAAGTTAGGCCCATGG - Intronic
1026706597 7:72699296-72699318 CATTTGCCATGTTAGAGCCATGG - Intronic
1027751525 7:82153532-82153554 TAGATACCACTTTAGATCCAAGG - Intronic
1029318586 7:99736808-99736830 CAGATTCCTTGTCAGATTCAAGG + Intergenic
1029323516 7:99785794-99785816 CAGATTCCTTGTCAGATTCAAGG + Intergenic
1033499958 7:141937551-141937573 GAGATGCTATCTTAGAACCAGGG - Intronic
1034126478 7:148676057-148676079 GAGATGCCATCTTAGAGCCAGGG - Intergenic
1037574659 8:20190068-20190090 CAGATGCCAGGTCAGATCCTGGG + Intergenic
1039100628 8:33938214-33938236 CTGATGCTATGTTAGATACCTGG + Intergenic
1039242836 8:35575372-35575394 CAGATGCCATGTTAGATCCATGG - Intronic
1039491234 8:37948952-37948974 CAGAAGCCTTGTTAGATTCTGGG - Intergenic
1039496722 8:37986059-37986081 CTGATGCCATTTGAGATCAAAGG + Intergenic
1042993743 8:74669765-74669787 GAGATGACATTTGAGATCCAAGG - Intronic
1045064977 8:98436591-98436613 CAAGTACCATGTTAGATGCAAGG + Intronic
1046650278 8:116830173-116830195 CAGAGGCAATGCTAGTTCCACGG + Intronic
1051300059 9:15639998-15640020 CAGATGCCATACTAGGTCCTTGG - Intronic
1052278085 9:26701374-26701396 CAGCTTCTATTTTAGATCCATGG - Intergenic
1055625006 9:78167609-78167631 CAGATTCCATGTCAGATCACCGG - Intergenic
1057644455 9:96859837-96859859 GAGATGCCATCTAAGAGCCAAGG - Intronic
1059581331 9:115551675-115551697 CAGATGCCTTTTTAAAACCAAGG - Intergenic
1061704268 9:132440690-132440712 CAGATGAGATGATAGATTCAAGG - Intronic
1186373159 X:8967499-8967521 CAGATGCCAACTTAGATACCAGG + Intergenic
1187626966 X:21125667-21125689 CAGATGGCATGCTAGATACCAGG - Intergenic
1187836283 X:23435389-23435411 CAGATGCCATCTGGGAGCCAGGG - Intergenic
1192991347 X:76460925-76460947 CAGCTTTCATGTTAGATTCAGGG - Intergenic
1193092634 X:77510818-77510840 AAGATGCTATCTAAGATCCAGGG - Intronic
1193706544 X:84826759-84826781 CAGATTTCATCTTTGATCCATGG + Intergenic
1196315095 X:114213071-114213093 CATATACCATGTTAGCCCCATGG - Intergenic
1197488795 X:127090112-127090134 GAGATGCCATATGAGAGCCAGGG + Intergenic
1199754448 X:150851336-150851358 CAGCTGCCATGTCAGACACATGG + Intronic