ID: 1039243471

View in Genome Browser
Species Human (GRCh38)
Location 8:35582252-35582274
Sequence CGGTGAAATAGGAGCTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039243471_1039243477 24 Left 1039243471 8:35582252-35582274 CCATGATAGCTCCTATTTCACCG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1039243477 8:35582299-35582321 AAAGCATCTTCCTGATGCAGTGG No data
1039243471_1039243475 1 Left 1039243471 8:35582252-35582274 CCATGATAGCTCCTATTTCACCG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1039243475 8:35582276-35582298 CATTGTTCATTCACTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039243471 Original CRISPR CGGTGAAATAGGAGCTATCA TGG (reversed) Intronic
904354097 1:29927219-29927241 CTGTGAAATGGGAACAATCACGG + Intergenic
908469752 1:64432208-64432230 CTGTGAAATAATAGCAATCACGG - Intergenic
912516753 1:110221106-110221128 GGGTGAAATAGCAGTCATCAGGG + Intronic
1064324309 10:14334358-14334380 CAGTGGAATATGAGCTATCCAGG + Intronic
1065773223 10:29096732-29096754 AGCTGGAATAGGAGCAATCAAGG - Intergenic
1080790901 11:35521646-35521668 CAGTAAAACAGGAGCTAGCAAGG + Intronic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1095858713 12:46890719-46890741 TGGTGAATAAGGAGCTGTCAGGG + Intergenic
1096785740 12:54016301-54016323 GGGTGGAGTAGGAGCTTTCAGGG + Intronic
1103823920 12:123720711-123720733 CAGTGAAAAAGGACCTCTCAAGG + Intronic
1107711304 13:43152980-43153002 AGGTGAAATAGAAGCCATGAGGG + Intergenic
1109641652 13:65199524-65199546 CTGTGAAGTAAGAGCTATCATGG - Intergenic
1110901337 13:80829422-80829444 TTGACAAATAGGAGCTATCAGGG - Intergenic
1115129627 14:30039201-30039223 AGGTGAAAGAGTAGCTATCTAGG + Intronic
1117087517 14:52216849-52216871 CGGGGAAATAGGATCTAAGAGGG - Intergenic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1118912898 14:70076658-70076680 AAGGGAAACAGGAGCTATCAAGG - Intronic
1119964018 14:78893050-78893072 TGGGCAAATAGGAGCAATCAGGG - Intronic
1120534304 14:85674320-85674342 AGGAGAAATAGGACATATCAGGG - Intergenic
1120567059 14:86072826-86072848 AGGGGAAATAGGAACAATCAAGG + Intergenic
1130029293 15:80296973-80296995 CAGTGAAATAGGAGGTGTGATGG - Intergenic
1133211657 16:4266521-4266543 TGGTGGAATAGGAGCTAACCAGG + Intronic
1138935153 16:61710697-61710719 TGGTGAAATGGGAGCCCTCATGG - Intronic
1139205658 16:65026008-65026030 GGGTGAAAATGGAGCAATCATGG + Intronic
1142373431 16:89695311-89695333 CCTTGAAATAGGAGCTCTCCAGG - Exonic
1143465989 17:7137048-7137070 GGATGAAACAGAAGCTATCACGG - Intergenic
1158689145 18:59644699-59644721 GGGAGAAATAGGAGGTATTAGGG - Intronic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1160090032 18:75818347-75818369 AGGTGAAAGAGAAGCTACCAGGG + Intergenic
1160779508 19:871664-871686 TGGGGAAATAGCAGATATCAAGG + Intronic
1162520697 19:11177892-11177914 GGGAGAAGTAGGAGCTAGCAAGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930281147 2:49371480-49371502 CAGTGTAATAGGAGCTCTTATGG - Intergenic
933182642 2:79244657-79244679 CAGTGAAATCGCTGCTATCATGG - Intronic
933600129 2:84320447-84320469 AGGGGAAATAGGAGCTTTCCAGG - Intergenic
933755386 2:85634169-85634191 AGGAGAAATAGGAGGAATCAAGG + Intronic
933842282 2:86297498-86297520 GGCTGACATAGGAGCCATCATGG + Intronic
936051493 2:109227471-109227493 TGGTGACATTGAAGCTATCAGGG + Intronic
939931082 2:148233963-148233985 GGGAGCAATAGGAGCTGTCATGG - Intronic
940423875 2:153509196-153509218 CGGGGAAACAGGAGCTTCCAGGG + Intergenic
941220691 2:162776561-162776583 AGGAGAAAGAGGAGCTATTAAGG + Intronic
946149143 2:217752644-217752666 CAGTGAAAGAGGAACTCTCACGG + Intronic
946152870 2:217787975-217787997 CTGTGAAATGGGAGTGATCACGG + Intergenic
948517930 2:238517273-238517295 TGCTGAAATAGGAGATAGCAGGG - Intergenic
1172105651 20:32515786-32515808 GGGTGAGCTAGGAGCTAGCAAGG + Intronic
1172523104 20:35582062-35582084 CAGTGAAATTGGGGCTCTCACGG + Intergenic
1175920783 20:62449768-62449790 AGGTGAAAGTGGAGCTAACATGG - Intergenic
1176524316 21:7853975-7853997 TGGTGAAATAGGAACTAACAGGG + Intergenic
1178658336 21:34483988-34484010 TGGTGAAATAGGAACTAACAGGG + Intergenic
1180311649 22:11245600-11245622 TGGTGAAAAAGGAAGTATCATGG - Intergenic
1181872338 22:25909951-25909973 CCGTGAAATAGGATCTCTGATGG + Intronic
953412666 3:42698980-42699002 TGGTGAAAGAGGAGCTGGCAGGG + Intronic
965837704 3:172869529-172869551 CAGTGAAATAGGAGCCTCCAGGG - Intergenic
967544629 3:190710276-190710298 CGGGCAAACAGGAGCTTTCATGG + Intergenic
970493916 4:16606440-16606462 GGGTGAAACAGGTACTATCAGGG - Intronic
977505397 4:97896193-97896215 AGGTGGAATAGGAGCTATGGTGG - Intronic
977864039 4:102001778-102001800 GGGTAAAATAGGAGCCAGCAGGG + Intronic
978441394 4:108737929-108737951 CTGTGGAATAAGAGCTATCATGG + Intergenic
982616343 4:157641347-157641369 CCATGAAATAGGAGCTGTAAAGG - Intergenic
983406574 4:167338721-167338743 TTGTGAAATATGAGCTATAAGGG - Intergenic
985773565 5:1827914-1827936 CCGTGAACTCGGAGCTCTCAGGG + Intergenic
986291836 5:6406437-6406459 CTATGAAATTGGAGCTGTCAAGG - Intergenic
986351382 5:6883049-6883071 TGGTGAAGTAGGATCTAGCATGG - Intergenic
987250985 5:16101146-16101168 CAGTCAAATAGGAGATAACATGG - Intronic
999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG + Intergenic
1001917653 5:175575126-175575148 TCCTGAAATAGGAGCTATCAGGG + Intergenic
1002776760 6:334628-334650 CAGTGAAATTGTAGCTGTCATGG + Intronic
1014406239 6:121055104-121055126 CAGTGAAATAAGAACTATAATGG + Intergenic
1022341165 7:29469537-29469559 CCATGAAATAGGAGCAAGCATGG - Intronic
1022596442 7:31718010-31718032 AGGTGAAATAGCAGGTAGCATGG + Intergenic
1023165515 7:37339449-37339471 TAGTGAAATAGCAGCTATCCAGG + Intronic
1039243471 8:35582252-35582274 CGGTGAAATAGGAGCTATCATGG - Intronic
1039657619 8:39427125-39427147 CTGTGAAATAGAAACTATGAAGG + Intergenic
1042392830 8:68255843-68255865 GGGAGAAATAGGAGATATCCAGG + Intergenic
1051854948 9:21553621-21553643 CTGTAAAATAGGAACAATCATGG + Intergenic
1055011249 9:71568553-71568575 GGGAGAAAAAGGAGCTATGATGG + Intergenic
1060125448 9:121040183-121040205 GGGTGAAGTAGGAGTTAACAAGG + Intronic
1186718178 X:12275505-12275527 TGAGGAAATAGGAGCTTTCATGG + Intronic
1191566003 X:62531880-62531902 TGGTGAAAAAGGAACTATCTTGG + Intergenic