ID: 1039244677

View in Genome Browser
Species Human (GRCh38)
Location 8:35595842-35595864
Sequence GTGCAAACACAGAAGTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039244677_1039244682 0 Left 1039244677 8:35595842-35595864 CCCATCTACTTCTGTGTTTGCAC 0: 1
1: 1
2: 0
3: 18
4: 188
Right 1039244682 8:35595865-35595887 AAGGCCCTTGGTAGGCAGCCTGG No data
1039244677_1039244681 -8 Left 1039244677 8:35595842-35595864 CCCATCTACTTCTGTGTTTGCAC 0: 1
1: 1
2: 0
3: 18
4: 188
Right 1039244681 8:35595857-35595879 GTTTGCACAAGGCCCTTGGTAGG 0: 1
1: 0
2: 1
3: 8
4: 98
1039244677_1039244686 5 Left 1039244677 8:35595842-35595864 CCCATCTACTTCTGTGTTTGCAC 0: 1
1: 1
2: 0
3: 18
4: 188
Right 1039244686 8:35595870-35595892 CCTTGGTAGGCAGCCTGGGTAGG No data
1039244677_1039244688 24 Left 1039244677 8:35595842-35595864 CCCATCTACTTCTGTGTTTGCAC 0: 1
1: 1
2: 0
3: 18
4: 188
Right 1039244688 8:35595889-35595911 TAGGATTTGACCTGTCTTCTTGG No data
1039244677_1039244689 30 Left 1039244677 8:35595842-35595864 CCCATCTACTTCTGTGTTTGCAC 0: 1
1: 1
2: 0
3: 18
4: 188
Right 1039244689 8:35595895-35595917 TTGACCTGTCTTCTTGGTTCTGG No data
1039244677_1039244683 1 Left 1039244677 8:35595842-35595864 CCCATCTACTTCTGTGTTTGCAC 0: 1
1: 1
2: 0
3: 18
4: 188
Right 1039244683 8:35595866-35595888 AGGCCCTTGGTAGGCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039244677 Original CRISPR GTGCAAACACAGAAGTAGAT GGG (reversed) Intronic
900814107 1:4830126-4830148 AAGTAAACACAGAAGTAGGTGGG + Intergenic
904643320 1:31946833-31946855 TTGAAAACACAGCAGCAGATAGG - Intergenic
904652011 1:32013240-32013262 GTGGAAACACTGAAGGCGATTGG - Intergenic
907613539 1:55899107-55899129 TTACAAACACAGAGATAGATTGG - Intergenic
908124132 1:61013439-61013461 TTGCAAACTCAGATGTGGATGGG - Intronic
908816987 1:68044543-68044565 GGGCAAAGATAGAAGTAGAGGGG + Intergenic
908949897 1:69547666-69547688 ATGCATAGACAGACGTAGATAGG + Intergenic
909143499 1:71897408-71897430 GTGACAACACAGAAGTTGAGGGG - Intronic
910382404 1:86642606-86642628 GTGCAATCACAGAAGCACATGGG + Intergenic
911285543 1:95987739-95987761 GTCCAAACACAGAAATATATTGG + Intergenic
911898517 1:103470608-103470630 GTGCAAAGACAGATGTAGAAAGG - Intergenic
912271974 1:108220759-108220781 GTACAAACACAGAATAACATAGG - Intergenic
912922158 1:113879605-113879627 CAGCAAACACAGCTGTAGATAGG - Intronic
913658594 1:120985582-120985604 GTGCCACAACAGAAGCAGATTGG + Intergenic
914009958 1:143768707-143768729 GTGCCACAACAGAAGCAGATTGG + Intergenic
914523207 1:148436828-148436850 GTGCCACAACAGAAGCAGATTGG + Intergenic
914648578 1:149677363-149677385 GTGCCACAACAGAAGCAGATTGG + Intergenic
916180658 1:162080680-162080702 ATGCACACACAGAAGTAGCAGGG - Intronic
916195321 1:162217110-162217132 GTGGAAACATAGAAGTACCTAGG - Intronic
917798532 1:178550046-178550068 ATGCAAACACAAAAGAAAATTGG + Intergenic
918059406 1:181048592-181048614 GTGCACACACAGAGGTGGAGTGG + Intronic
918336905 1:183524917-183524939 GTACAAAAAGAGAAGTAGAGGGG - Intronic
920395733 1:205644596-205644618 GTGTAAACACAGAGCTAGAGTGG + Intergenic
920775867 1:208936535-208936557 GTGGAAACAAAGATGTAGAGTGG - Intergenic
1062871111 10:905549-905571 TTGCAAAGACAGGAGTAAATGGG - Intronic
1063894798 10:10668567-10668589 GAGTAAAAACAGAAGTAGTTGGG - Intergenic
1064562120 10:16604104-16604126 CTGCCAACACAGAACTAGCTGGG + Intronic
1069672064 10:70215410-70215432 TTCCCAAAACAGAAGTAGATAGG + Intronic
1071028803 10:81146988-81147010 GTGCAAAGAAAGTAGTGGATGGG - Intergenic
1073755245 10:106574398-106574420 GTGCAAACACACAAGGAGTTTGG - Exonic
1073900060 10:108209962-108209984 GTACATACCCAGAAGTAGAATGG + Intergenic
1073929656 10:108560382-108560404 GAGCAAACACAAAAGTGAATTGG - Intergenic
1074167344 10:110894946-110894968 GTGTAAATAGAGAAGTAGATGGG + Intronic
1074284693 10:112087248-112087270 TTGGAAATACAGAAGTAAATGGG + Intergenic
1077548810 11:3190181-3190203 GTGCAAAGACACAAATAAATAGG + Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082620317 11:55412605-55412627 CTGAAAAGACAGAAGTAAATAGG - Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087654567 11:100906912-100906934 GTGGAAACAGAAAAGGAGATGGG - Intronic
1088766768 11:112989342-112989364 GTGCAAACTCAAATATAGATAGG - Intronic
1093189235 12:16056124-16056146 GTGCAAATACACAATTCGATAGG + Intergenic
1093421433 12:18978873-18978895 ATGCAAGCACAAAAGGAGATAGG - Intergenic
1094310192 12:29072101-29072123 GTGCTAACACAGGAATAGATAGG + Intergenic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1098961934 12:76747921-76747943 GTGCAAACACAGGAGTATGAGGG + Intergenic
1100711152 12:97258292-97258314 TTGCACACACACAAGTACATTGG + Intergenic
1101381768 12:104219527-104219549 GTGTAATCATAAAAGTAGATGGG + Intronic
1104794945 12:131510945-131510967 GGTCAAACACAGAAGGAGAGGGG + Intergenic
1108686394 13:52822768-52822790 GTGCCAACACAAAAATAAATGGG + Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1112247865 13:97750677-97750699 GTGCCAAAACAGAATTAGACAGG - Intergenic
1112347738 13:98604978-98605000 GTGAAAATACAGAAGAAAATGGG + Intergenic
1116420681 14:44728326-44728348 GGACAAACAAAGTAGTAGATGGG - Intergenic
1119316203 14:73697263-73697285 GTAAAATCACACAAGTAGATGGG - Exonic
1122060601 14:99134386-99134408 GTGCAAAGGCAGAAGCAGAGAGG + Intergenic
1125171086 15:36767549-36767571 GTGCAAACAGAGAAGCAGGTGGG + Intronic
1125252070 15:37716048-37716070 TTGCGGACACAGAAGTAGATAGG - Intergenic
1125539016 15:40459144-40459166 GTGCCCATGCAGAAGTAGATGGG + Exonic
1126980422 15:54236623-54236645 GTGCAAACACAGACCAAAATAGG + Intronic
1128310132 15:66625465-66625487 GTCCAGACACAATAGTAGATGGG + Intronic
1130804681 15:87307260-87307282 GTGCAAACAAAGAAGTAGATAGG - Intergenic
1131408108 15:92183281-92183303 TTGCAAAGACAGAAGTAGTATGG - Intergenic
1131625121 15:94109503-94109525 GTGCAAAGAGAGATGTAGTTGGG - Intergenic
1134880987 16:17745401-17745423 GAGCAAACAGAGAAGGAGAGAGG - Intergenic
1135871548 16:26155998-26156020 ATGGAAACACAAAAGTAGAGAGG - Intergenic
1137740230 16:50763057-50763079 ATGCAGAGACAGAAGTAGACTGG - Intronic
1138018945 16:53459029-53459051 CTGCAAAAATAGCAGTAGATGGG + Intronic
1138272964 16:55709517-55709539 GTGAAAACACAGTGGTAGCTGGG - Intergenic
1141612447 16:85190022-85190044 TTGCAAAAACAGAACAAGATAGG - Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1145828089 17:27892600-27892622 GTACAGAGACAGAAGTACATTGG + Intronic
1146583155 17:34057983-34058005 GTGCACGCACACAAGTACATGGG - Intronic
1147219843 17:38922053-38922075 GTGGAAAGCCAGAAGTAGGTTGG - Intergenic
1148190880 17:45677897-45677919 GTGCAAACCCAGAATAAGCTGGG - Intergenic
1148485850 17:47990528-47990550 ATGTCAACACAGAAGTTGATGGG - Intergenic
1149681184 17:58508412-58508434 ATCCAAACACGGAAGTAGTTTGG + Intronic
1151412212 17:73938543-73938565 GTGCAAACCAAGAAGAAGCTGGG + Intergenic
1152850639 17:82632633-82632655 TTGCAGACACAGAAGTGGGTGGG - Intronic
1152916725 17:83041160-83041182 TAGCAAACACAGAGATAGATGGG + Intronic
1155590740 18:27424472-27424494 GTGCCAACAGAGAAGGAGATCGG - Intergenic
1155744846 18:29342052-29342074 GAGCAAGCATAGAAGCAGATAGG - Intergenic
1156708121 18:39908524-39908546 GGGCAAACCCAGAAGAAGTTTGG - Intergenic
1158157136 18:54438720-54438742 ATGCAAAGGCAGAAGTAGAAAGG - Intergenic
1159119787 18:64155161-64155183 GTGCAAAAACACAAGCTGATTGG - Intergenic
1159947922 18:74457498-74457520 GTGCAAAAAGAAAAGTAGAGAGG - Intronic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160339495 18:78076146-78076168 GTGCACTCACAAAAGTTGATAGG - Intergenic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1162673210 19:12276207-12276229 GTGCAGACACAGAATAAGAGTGG - Intronic
925711906 2:6749447-6749469 CTACAACCACAGAAGGAGATGGG + Intergenic
926942451 2:18152611-18152633 ATGCAAACACAGAAAGAGAAAGG - Intronic
927058967 2:19395942-19395964 GTGCAATAACAGATGAAGATGGG + Intergenic
927557308 2:24044681-24044703 GGGCTAACACAGGAGTAGAAAGG - Intronic
927734435 2:25506180-25506202 GTACAAACACAGAGTTAGATGGG + Intronic
931046403 2:58358725-58358747 GTGGAAACACAGAACTAGTTAGG - Intergenic
931930340 2:67126191-67126213 GTGTAAATACAGTAGGAGATTGG + Intergenic
933651150 2:84851254-84851276 CTGCAAACACTCAAGGAGATGGG + Intronic
935888936 2:107654564-107654586 CTGCAGACACAAAAGTAGTTAGG + Intergenic
936022855 2:109008197-109008219 GTGAAAATACAGAAGCACATAGG - Intergenic
938564411 2:132505497-132505519 GTACAAACATAGAGTTAGATAGG - Intronic
938691394 2:133792727-133792749 CTGAAAACACAAAACTAGATGGG + Intergenic
939906073 2:147917029-147917051 TTACAAACACAGAAGGTGATCGG - Intronic
939993258 2:148896305-148896327 CTGCAAACAAAGGAGTAGAGAGG + Intronic
943178439 2:184509420-184509442 TAGCAAACACAGAACTTGATAGG + Intergenic
943223398 2:185139033-185139055 ATGCAAAAACAGAATTAGCTGGG - Intergenic
944670919 2:201993813-201993835 GTGCAAACGCTCAAGTAGGTGGG + Intergenic
944943561 2:204656461-204656483 CTGTAAACAGTGAAGTAGATTGG - Intronic
945435417 2:209811669-209811691 GTTCAAACACAGAAGTGAGTTGG - Intronic
948261437 2:236607085-236607107 GTGCAGACACAAAAGCAGAGCGG - Intergenic
948558342 2:238833710-238833732 ATGCACACACAGAAGTAAAGAGG - Intergenic
948720538 2:239897461-239897483 GTTTAGACACAGGAGTAGATTGG + Intronic
949077174 2:242067926-242067948 GTTAAAAAACAAAAGTAGATGGG + Intergenic
1170292404 20:14785331-14785353 GTGCAAACATAGAAATGGGTGGG - Intronic
1170346474 20:15392490-15392512 ATGCAAAAACAGAAGTAATTGGG - Intronic
1172327796 20:34050570-34050592 GCACAGACACAGAAGTAGTTGGG - Intronic
1174265043 20:49325292-49325314 GTGCAAACACATTAGGAGTTGGG + Intergenic
1177002417 21:15630725-15630747 GTACATACACAGAAGTGGAATGG - Intergenic
1177580466 21:23015786-23015808 GTGCAAACGCACAAGAAGCTTGG - Intergenic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
949388928 3:3537516-3537538 ATGAAACCACAGAAGTAGAGTGG + Intergenic
950594141 3:13964117-13964139 GTGAAAATAAAAAAGTAGATTGG - Intronic
951057246 3:18161932-18161954 TTTCAAACACAGGAGTAGAAAGG + Intronic
951645996 3:24891919-24891941 CTGCACCCACAGAAGTAGATGGG + Intergenic
952079987 3:29746395-29746417 GTACAAACACAGCTGTAGTTTGG - Intronic
952253839 3:31678864-31678886 GTGCAAAGATAGAAGCAGAGAGG - Intronic
952563747 3:34629414-34629436 ATGCAAAAAGAAAAGTAGATGGG + Intergenic
953182938 3:40613466-40613488 GTGGAAGTAGAGAAGTAGATAGG + Intergenic
953776517 3:45822173-45822195 TTGCAAACTCAGGAGTAGATGGG - Intergenic
955878662 3:63521090-63521112 GAGCAGACACAGCAGTAGCTGGG - Intronic
955914559 3:63893710-63893732 GTGAAAACACACAAGTGGAGAGG - Intronic
956000501 3:64724939-64724961 ATGCAAAGACAGGAGAAGATGGG - Intergenic
956666280 3:71645116-71645138 TTGCAGACACTGAAGCAGATTGG + Intergenic
957855703 3:85874409-85874431 ATGCATACACAAAGGTAGATTGG - Intronic
958424719 3:93966975-93966997 GGCCAAACACAGAAGTTTATAGG + Intronic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963240092 3:142994502-142994524 ATGGAAACACAGGAGAAGATTGG - Intronic
966371595 3:179256110-179256132 GAGCAAATACAGAAGTAAACAGG + Intronic
969386181 4:6850094-6850116 GAGCAGACACAGAAGTGGAAGGG + Intronic
970350935 4:15201252-15201274 GTGGAGATATAGAAGTAGATGGG + Intergenic
970926872 4:21462202-21462224 GTGAAAACACACAAATACATGGG - Intronic
973188223 4:47355915-47355937 GAGCAAACACAGACTTAGAAGGG - Intronic
977115050 4:93013690-93013712 GTGCAAATACAGATTTACATAGG - Intronic
978936408 4:114382746-114382768 GGGCAAGGACAGAAGCAGATTGG - Intergenic
978978138 4:114906318-114906340 GTGCAAACATAAAACTAGAAGGG - Intronic
979940921 4:126761916-126761938 ATGCACACACAGAAGTAGGAAGG + Intergenic
982435053 4:155375722-155375744 GTGTAAACACTGTATTAGATGGG - Intronic
983678832 4:170328977-170328999 GTCCAGAGACAGAAGGAGATAGG + Intergenic
985748018 5:1658267-1658289 GTGCATGAACAGAAGTACATGGG - Intergenic
987372359 5:17204652-17204674 TTGCAAAAACAGAAGCAGAAAGG + Intronic
987730904 5:21771470-21771492 ATGGAATCACAGAAGTATATTGG - Intronic
988283130 5:29175492-29175514 AGGGAAACAGAGAAGTAGATTGG + Intergenic
991325756 5:65430327-65430349 CTGCAAAAACAGAATTAGAGAGG + Intronic
991931083 5:71752911-71752933 GTTCAAACAAAGAAGGAAATTGG - Intergenic
993308566 5:86299251-86299273 GTACAAACACAGAATAACATAGG + Intergenic
994649694 5:102511084-102511106 GTTCACATACAGAAGTAGATAGG + Intergenic
995326634 5:110897137-110897159 TTGTAACCACAGAAGTAAATGGG + Intergenic
995357379 5:111254649-111254671 GTACATACTCAGGAGTAGATGGG - Intronic
998440112 5:142152578-142152600 GAGCAAAGAAAGAAGTAGCTTGG + Exonic
998556038 5:143124636-143124658 GGGCAAACACAGAAGCAGCAAGG + Intronic
999387948 5:151168762-151168784 GTGCAAAAACAGCCATAGATGGG + Intergenic
999959612 5:156740524-156740546 GTGGCAACACAGAAGTATAATGG + Intronic
1001179501 5:169506134-169506156 TTGCAAGCACAGTAGTTGATTGG + Intergenic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003269570 6:4595514-4595536 GTACAAAAACAAAAGTAGCTGGG - Intergenic
1004469231 6:15914154-15914176 GTGCATACCCAGAAGCAGAATGG - Intergenic
1006524900 6:34595953-34595975 ATGCAAACACAGAAGAATACAGG + Intronic
1006893470 6:37449877-37449899 GTGGAGACACAGAAGTAAACAGG - Intronic
1008326605 6:50189458-50189480 GTGGAAGCACAAAAGTAGCTAGG + Intergenic
1009392283 6:63158327-63158349 GTCCAAACAGAGTAGTAGAAAGG + Intergenic
1010682175 6:78809691-78809713 GTGTAAAGACTGATGTAGATTGG - Intergenic
1021249073 7:18302171-18302193 GTGCAAACAAACAAGTAGACTGG - Intronic
1021680962 7:23131479-23131501 ATGCAAACACAAAAATAAATAGG - Intronic
1023350701 7:39317766-39317788 GTGCACACAGAGAAGAAGGTAGG - Intronic
1024923207 7:54582946-54582968 GTACAAACATATAATTAGATAGG + Intergenic
1026805600 7:73427850-73427872 GTGCACACACAGGAGTAAACAGG + Intergenic
1027488512 7:78791866-78791888 GTGCAAACACAGTAGGGGGTAGG + Intronic
1027630358 7:80596641-80596663 GTGGGAACCCAGAAGTAGACAGG + Intronic
1029546782 7:101214539-101214561 ATGGAATCACAGAAGTAGACCGG + Intronic
1029788386 7:102816584-102816606 GTGCAAACACACAGCTACATAGG - Intronic
1030414186 7:109220027-109220049 GTGAAAGCTTAGAAGTAGATGGG + Intergenic
1030912352 7:115266098-115266120 GTGAAAACACAGAATTAAAGAGG - Intergenic
1031074293 7:117198297-117198319 CTGCAAGCACAGAAATAGAACGG - Intronic
1032435663 7:131898377-131898399 GAGCAAACCCAGGAGTAGACTGG + Intergenic
1033009595 7:137606346-137606368 TTTCAAAGACAGAAGGAGATAGG + Intronic
1033875546 7:145812847-145812869 GTGAAAACAGAGAAGCAGAAGGG + Intergenic
1039244677 8:35595842-35595864 GTGCAAACACAGAAGTAGATGGG - Intronic
1040395252 8:46992645-46992667 GAGCAAACACAGCAGTTAATGGG - Intergenic
1040425499 8:47280868-47280890 TTACAAACAAAGAAGTAGAAAGG - Intronic
1041742642 8:61173162-61173184 ATGCACACACACAAGTAGATAGG + Intronic
1042012384 8:64261818-64261840 TTGCAAACACAGAAGGATGTAGG - Intergenic
1045269941 8:100653006-100653028 GAGCAAACACAGAAAGGGATAGG + Intronic
1046104303 8:109647513-109647535 GTGAAAACAAACAAGTAAATGGG - Exonic
1046105420 8:109659683-109659705 GTGGAAAAACAGTAGTAGAAGGG - Intronic
1047323200 8:123808893-123808915 GTGCCACAACAGAAGCAGATTGG + Exonic
1049507061 8:143008463-143008485 GTGCAAACACACAGGTACACTGG + Intergenic
1050662323 9:7895976-7895998 GTGCAAACACATAAGAAAAGAGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051422471 9:16902537-16902559 GTAAAAGCACAGAAGTATATAGG - Intergenic
1059092493 9:111374973-111374995 GTGCAACCACAGAAATAAAATGG + Intronic
1059817777 9:117937355-117937377 GTGCAGATAAAGAAGTACATTGG - Intergenic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1189587869 X:42479314-42479336 GGGCCAACACAGAAATAGAAAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191161452 X:57333957-57333979 GAGCAAAGACAGAATTATATTGG + Intronic
1194552515 X:95319583-95319605 CTGCATCCACAGCAGTAGATGGG + Intergenic
1195767989 X:108317042-108317064 GGGCAAGCACAGAAGCAGAAAGG + Intronic
1197976307 X:132169222-132169244 GTGCACACACAGGAGAAGATGGG - Intergenic