ID: 1039246851

View in Genome Browser
Species Human (GRCh38)
Location 8:35618184-35618206
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039246849_1039246851 2 Left 1039246849 8:35618159-35618181 CCAGAACTTGACAAGAGCAGTCA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1039246851 8:35618184-35618206 CTAGTTCATCAGTCATCTGTGGG No data
1039246848_1039246851 5 Left 1039246848 8:35618156-35618178 CCACCAGAACTTGACAAGAGCAG 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1039246851 8:35618184-35618206 CTAGTTCATCAGTCATCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr