ID: 1039247830

View in Genome Browser
Species Human (GRCh38)
Location 8:35629100-35629122
Sequence GCTTGCTACTGAAATAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039247830_1039247832 2 Left 1039247830 8:35629100-35629122 CCAGTACTATTTCAGTAGCAAGC 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1039247832 8:35629125-35629147 TTTTCTCCCCACCTAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039247830 Original CRISPR GCTTGCTACTGAAATAGTAC TGG (reversed) Intronic
905103677 1:35548261-35548283 GCATGTTAATGAAATAGTCCAGG - Intronic
911063448 1:93767043-93767065 GCTGGCTACTTAAATAGAAAAGG - Intronic
919427859 1:197456260-197456282 GCTGGCTACTGAAAAAGTCAAGG - Intronic
920428949 1:205902366-205902388 GCTTGCTCCTGAATGACTACTGG + Intergenic
920753569 1:208705564-208705586 GCCTGCTCCTGAATGAGTACTGG + Intergenic
924652198 1:245939833-245939855 TCTAGCTACTGAAATACCACTGG + Intronic
1063573362 10:7237845-7237867 GTTTGCTACTGAGATTGAACAGG + Intronic
1066273034 10:33842030-33842052 GCTTGCTTCTGAAATTGTGTTGG - Intergenic
1072816769 10:98517252-98517274 GTGTGCTACTGACATAGGACAGG - Intronic
1079070822 11:17345120-17345142 GCTTGTGACTAAAATAGTTCTGG + Intronic
1083451018 11:62745281-62745303 GCTTGCTGATGAAATTGTACAGG + Intergenic
1083479998 11:62937926-62937948 GGAGGCTACTGCAATAGTACAGG - Intronic
1085014954 11:73167879-73167901 GCTTCCTGCTGTAATATTACAGG + Intergenic
1086767322 11:90713465-90713487 GTTTGCTACTGAAATATTAGGGG + Intergenic
1089453583 11:118612854-118612876 ACTTGCTGCTGAAATGTTACTGG - Intronic
1093865807 12:24226293-24226315 GCTTGTTCCTGCAATAATACAGG - Intergenic
1098007475 12:66013499-66013521 GCTTTCTGCTGAAATAGGATGGG + Intergenic
1100710341 12:97249399-97249421 GCTTGATACTGACAAAATACTGG - Intergenic
1101316084 12:103630178-103630200 TCATGCTACTGCAATAGTCCAGG + Intronic
1102960612 12:117091033-117091055 GCTTGCTCCTGACAGAGTGCCGG + Intronic
1111176215 13:84599688-84599710 GGTGGCTACTAAAATAATACAGG - Intergenic
1115377743 14:32696531-32696553 GCTTGCTGCTGCCAAAGTACAGG + Intronic
1118856627 14:69628386-69628408 GCTTGCTACAGAGATACTGCTGG + Intronic
1119873561 14:78037142-78037164 CCTTGCTTCTGAAAGAGTTCTGG + Intergenic
1124142757 15:27091874-27091896 GTTTGCCACTGAAACAGGACAGG - Intronic
1124992937 15:34693532-34693554 GCTTCCCACTGACATAGTTCAGG - Intergenic
1128041896 15:64582345-64582367 GCTTGATACTGAAATAACAGAGG - Intronic
1143019052 17:3907201-3907223 GCTTGCAAATGAAATAGTCCTGG + Intronic
1150668184 17:67164973-67164995 GAAAGCTACTGAAATAGTCCGGG + Intronic
1150692543 17:67378153-67378175 CCATGCTGCTGAAAGAGTACCGG + Exonic
1154400584 18:14033174-14033196 CCTTGCTTCTGAAACAGTTCTGG + Intergenic
925713462 2:6764042-6764064 ACTTGCTACTGAAATAATTCAGG - Intergenic
930137390 2:47915979-47916001 GCTTACTAATAAAATGGTACTGG + Intergenic
930440164 2:51394376-51394398 ACCTGCTCCTGAAAGAGTACTGG + Intergenic
930477010 2:51894201-51894223 ACTTGCTCCTGAATGAGTACTGG + Intergenic
931160527 2:59685471-59685493 GGATGCTACTGCAATAGTGCAGG - Intergenic
940593733 2:155764376-155764398 ACCTGCTACTGAAAGACTACTGG - Intergenic
1170145108 20:13164785-13164807 TCTTGCAACTGAAATATTCCCGG + Exonic
1173790041 20:45822638-45822660 GCTTACTCCTCAAATTGTACTGG - Intergenic
1178290929 21:31367237-31367259 GCTTGCAACTGAAAGACTGCTGG - Intronic
1180162678 21:46005385-46005407 GCTTGGTACTGAAATACCCCTGG + Intergenic
1181576400 22:23798045-23798067 ACTTGCTACTGAGATAGGGCAGG + Intronic
1182107723 22:27701168-27701190 TCTTGCTGCTGGGATAGTACAGG - Intergenic
950561703 3:13733657-13733679 GCCTGCTACTGAATGACTACTGG - Intergenic
953436098 3:42878966-42878988 CCTTGCTACTTATAGAGTACAGG - Intronic
956499278 3:69864529-69864551 GTTAGCTACTGCAATAGTCCTGG - Intronic
957383726 3:79468141-79468163 GTTTGCCACTTAAATATTACTGG - Intronic
957904387 3:86538609-86538631 GCTTCCTACTTAAAAAGGACTGG - Intergenic
963534342 3:146509515-146509537 GATTGCTACTGAGTTAGTAAAGG + Intergenic
965933837 3:174081000-174081022 GCTACCTACTGTAATAGTTCTGG + Intronic
969081478 4:4621894-4621916 GCATGCAACAGAAATATTACTGG + Intergenic
970805616 4:20027370-20027392 ATTTGCAACTGAAATAGTTCTGG - Intergenic
974082982 4:57231745-57231767 GCTTGATACTGAACTAGTTCAGG - Intergenic
975465264 4:74701990-74702012 GCTTGGCACTGAACAAGTACAGG - Intergenic
976448853 4:85163913-85163935 GCCTGCTCCTGAATTACTACTGG - Intergenic
978618313 4:110616651-110616673 GCTTGTTCCTGAAATTATACAGG - Intergenic
984325312 4:178242861-178242883 GCTGGCTACTGACATGGCACAGG - Intergenic
994642228 5:102424005-102424027 ACTTGCTACTGAATGACTACTGG + Intronic
999184227 5:149693673-149693695 GCTTGCTGATGAAATAGCAAAGG + Intergenic
1003367859 6:5493993-5494015 TCTTGCTGCTGAAATAGCGCTGG - Intronic
1004546217 6:16601040-16601062 GCTTGCTCCTGAAATTATACGGG + Intronic
1006259173 6:32853885-32853907 GCTTGCTACCAAAATAGTCTGGG - Exonic
1007316073 6:40990337-40990359 GGTTTCTACTGAAATAGTCCAGG + Intergenic
1009875699 6:69502205-69502227 GCTTGCTCCTGAATGAGTAATGG + Intergenic
1010087947 6:71943079-71943101 GGTTACTACTAAAATAGTACTGG + Intronic
1010123492 6:72406793-72406815 GCTTGCTAATGAAATCATCCAGG - Intergenic
1011806649 6:91079933-91079955 GCTTGCTCCTAAAATGGTAAAGG - Intergenic
1015876595 6:137828771-137828793 GCTTGGTACTGAAATGGAAGTGG - Intergenic
1018509403 6:164509228-164509250 GCTGGCTGCTGAAAGAGAACAGG - Intergenic
1018647426 6:165961367-165961389 GCTTCCTTCTGAAGTAGGACAGG - Intronic
1024341174 7:48262264-48262286 GCTTTCTACTGACATAGGAGAGG + Intronic
1024378607 7:48668038-48668060 TCTTCCTACTGAAAGAGGACAGG + Intergenic
1024582543 7:50811749-50811771 ACTTGCTACTCCAAAAGTACTGG - Intergenic
1028844871 7:95468392-95468414 ACTTTTTACTGAATTAGTACTGG - Intergenic
1039247830 8:35629100-35629122 GCTTGCTACTGAAATAGTACTGG - Intronic
1043081025 8:75765160-75765182 ACTTGCTTCTGAATGAGTACTGG + Intergenic
1046965012 8:120154451-120154473 GCTTGTTACTGAAAGTGTAGGGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1058340999 9:103896308-103896330 GGTTGCTACAGAAATAGTTATGG - Intergenic
1058511221 9:105719730-105719752 GATTGCTATTGTAATAGTATAGG + Intronic
1058617527 9:106847748-106847770 ACTTACTACTGAAATATTACAGG - Intergenic
1059875328 9:118628365-118628387 GCATGCTACTGAAATAGAGATGG - Intergenic
1060453650 9:123768157-123768179 ACCTGCTACTGAAATATTCCTGG + Intronic
1061062340 9:128256959-128256981 GCTTGCTACTGTAAGGGTAAAGG + Exonic
1188168841 X:26895510-26895532 GCATGCTACTGAAAGATTATTGG + Intergenic
1188311530 X:28623036-28623058 GTTTGTTTCTGAAATAGTAAAGG - Intronic
1189561646 X:42196963-42196985 GCTTGCAACTGAAAGAGTCCTGG + Intergenic
1192009519 X:67253076-67253098 ACTTGCTCCTGAAAGACTACTGG + Intergenic
1192990254 X:76445272-76445294 GCTTGGTATCGAAATAATACTGG + Intergenic
1194342169 X:92718463-92718485 ACTTGCTCCTGAAAGACTACAGG + Intergenic
1197032158 X:121829521-121829543 GCTTTCAAATGAAATATTACTGG + Intergenic
1200650527 Y:5835159-5835181 ACTTGCTCCTGAAAGACTACAGG + Intergenic