ID: 1039250180 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:35654956-35654978 |
Sequence | AATGATGCACAGATGGAAAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039250173_1039250180 | 13 | Left | 1039250173 | 8:35654920-35654942 | CCCTTCTCTGAAGTCCTATGACT | 0: 1 1: 0 2: 2 3: 30 4: 252 |
||
Right | 1039250180 | 8:35654956-35654978 | AATGATGCACAGATGGAAAGTGG | No data | ||||
1039250174_1039250180 | 12 | Left | 1039250174 | 8:35654921-35654943 | CCTTCTCTGAAGTCCTATGACTT | 0: 1 1: 0 2: 3 3: 27 4: 264 |
||
Right | 1039250180 | 8:35654956-35654978 | AATGATGCACAGATGGAAAGTGG | No data | ||||
1039250178_1039250180 | -1 | Left | 1039250178 | 8:35654934-35654956 | CCTATGACTTGAGGGTGGTAAAA | 0: 1 1: 0 2: 1 3: 9 4: 109 |
||
Right | 1039250180 | 8:35654956-35654978 | AATGATGCACAGATGGAAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039250180 | Original CRISPR | AATGATGCACAGATGGAAAG TGG | Intronic | ||
No off target data available for this crispr |