ID: 1039250180

View in Genome Browser
Species Human (GRCh38)
Location 8:35654956-35654978
Sequence AATGATGCACAGATGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039250173_1039250180 13 Left 1039250173 8:35654920-35654942 CCCTTCTCTGAAGTCCTATGACT 0: 1
1: 0
2: 2
3: 30
4: 252
Right 1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG No data
1039250174_1039250180 12 Left 1039250174 8:35654921-35654943 CCTTCTCTGAAGTCCTATGACTT 0: 1
1: 0
2: 3
3: 27
4: 264
Right 1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG No data
1039250178_1039250180 -1 Left 1039250178 8:35654934-35654956 CCTATGACTTGAGGGTGGTAAAA 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039250180 Original CRISPR AATGATGCACAGATGGAAAG TGG Intronic
No off target data available for this crispr