ID: 1039250431

View in Genome Browser
Species Human (GRCh38)
Location 8:35658393-35658415
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039250427_1039250431 24 Left 1039250427 8:35658346-35658368 CCTCTTTAGTTGGGATTAATATT 0: 1
1: 0
2: 0
3: 17
4: 235
Right 1039250431 8:35658393-35658415 TTGCACCATCTTTGAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr