ID: 1039250815

View in Genome Browser
Species Human (GRCh38)
Location 8:35662091-35662113
Sequence TCATAGAGAAAATGCTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039250815 Original CRISPR TCATAGAGAAAATGCTGGAA TGG (reversed) Intronic
900259065 1:1714072-1714094 CCAAAGAGAAAATGTTGAAAGGG - Intronic
902320793 1:15664065-15664087 TCAAAAATAAAATGATGGAAGGG - Exonic
903818998 1:26086687-26086709 GCACAGAGAACATGCTGGGATGG + Intergenic
903862786 1:26375009-26375031 TCATAGAAAAATGTCTGGAAGGG - Intergenic
905827442 1:41036687-41036709 TCAAAGAGAAAAGCCTGGAAAGG - Intronic
906236099 1:44211874-44211896 ACATAGAAAAAATTCTGGAAAGG - Intergenic
906393586 1:45440843-45440865 TCATAGAGAAAAGGCCACAATGG + Intronic
907114169 1:51954355-51954377 TCATAGAGAAGAAACTGGAAAGG + Intronic
907983549 1:59508216-59508238 CCATGTAGAAAATGCTAGAAAGG - Intronic
908092909 1:60705334-60705356 ACTTAGGGGAAATGCTGGAATGG - Intergenic
908365228 1:63415387-63415409 TCATAAAGAACAAGGTGGAAAGG - Intronic
909591487 1:77353862-77353884 CCATAGAGAAAAGGGAGGAAAGG + Intronic
909794336 1:79714241-79714263 TAATAGAGAAAGTCCAGGAATGG - Intergenic
910073314 1:83245861-83245883 ACATAGAAAAAATGCTTAAATGG - Intergenic
910339744 1:86172543-86172565 ACATAGAGATGAGGCTGGAACGG + Intergenic
912014173 1:105011734-105011756 TTATAGGGAAAGTGCTGGTAGGG - Intergenic
912899463 1:113632267-113632289 TCATGGATAAAATGTTGAAAAGG - Intronic
913345818 1:117810352-117810374 GCAGAGAAAAAATGCAGGAAAGG - Intergenic
915253986 1:154611619-154611641 GCACAGGGAAAATGCTCGAAGGG - Intronic
916253245 1:162759397-162759419 TCATAGAGTAAATGAGGAAATGG - Intronic
916815285 1:168345701-168345723 TCATAAAGAAAATTCTGGCCTGG - Intergenic
917506461 1:175631752-175631774 ACATAGAGAAAACCATGGAAAGG + Intronic
918439633 1:184553982-184554004 TAATGCAGAAACTGCTGGAATGG - Intronic
918827125 1:189338551-189338573 TGAAAGAGAAAAAGCTGGAAGGG + Intergenic
919124192 1:193376674-193376696 GGATTGAGAGAATGCTGGAATGG - Intergenic
919180330 1:194072132-194072154 TCACAGAGAAAGAGCTGCAATGG + Intergenic
920203868 1:204277359-204277381 CCAAGGAGAAAATGCTGAAATGG + Intronic
920384537 1:205560567-205560589 TGATAAAAAAAATGCTGGTAAGG + Intergenic
920588204 1:207189493-207189515 TCAGAGATATAATACTGGAAGGG + Intergenic
923224463 1:231926366-231926388 TAATATACAAAATTCTGGAAAGG + Intronic
923824256 1:237482156-237482178 TCAAAGAAGAAATGCTTGAAAGG - Intronic
924387867 1:243516432-243516454 TCATAGAGAAAATTGATGAAAGG - Intronic
924654084 1:245957120-245957142 TGATACAGAAAATGATGAAAAGG + Intronic
924679220 1:246214670-246214692 CCTTATAGAAAATGCTGGATAGG - Intronic
1064823085 10:19361746-19361768 ACATAGATAAAATGTTGAAATGG - Intronic
1066806749 10:39263812-39263834 TCATACTGAAAATGGTGAAATGG + Intergenic
1067914453 10:50381477-50381499 TGATAGAGAAAATTCACGAAAGG - Intronic
1068412139 10:56669764-56669786 TCATAAAGAAAATGAGGAAATGG - Intergenic
1068822982 10:61399713-61399735 CCATAGAGAAAATGCTAGTTTGG - Intergenic
1068907263 10:62340543-62340565 TCATTCAGAAAGTGCTGGTATGG + Intergenic
1069081779 10:64096222-64096244 CCATAGCTAACATGCTGGAAGGG - Intergenic
1069689061 10:70337719-70337741 GTATGGACAAAATGCTGGAAGGG - Intronic
1070778222 10:79122598-79122620 TCACAGAGTAAAGGTTGGAAGGG - Intronic
1071778721 10:88818634-88818656 CCATAGAAACAATACTGGAAGGG + Intronic
1073140884 10:101246850-101246872 TGATGGAGAAAGTTCTGGAAAGG + Intergenic
1074242316 10:111651491-111651513 TCATAAAGAAAATGTTTCAAGGG - Intergenic
1075032631 10:119035272-119035294 TCATATTTAAAATGCTTGAAAGG + Exonic
1075811168 10:125226245-125226267 TCACAGAGAAAGGGCTGAAAAGG - Intergenic
1076562292 10:131375133-131375155 GCAGAGAGAAAAAGCTGGAGTGG - Intergenic
1078406291 11:11072734-11072756 TCATAGAAAAAATGCTAAAAGGG + Intergenic
1078822371 11:14894802-14894824 TCAAAGAGCAAATGCAAGAAGGG - Intergenic
1079065157 11:17284317-17284339 TCACAAAGAAAAGTCTGGAAGGG - Intronic
1079446728 11:20563766-20563788 TCATTGAGAAGATGCTGCAGAGG - Intergenic
1081062369 11:38495990-38496012 TTATAGGGAAAATGAGGGAAGGG + Intergenic
1081392489 11:42545280-42545302 TCTTAGAGAAAATGGCAGAATGG - Intergenic
1082120931 11:48378920-48378942 TAATAGGGAAGATGGTGGAAAGG - Intergenic
1082642357 11:55678966-55678988 ACAGAGAGAAAACACTGGAAAGG + Intergenic
1083184724 11:61010861-61010883 TCATGGATTAAATGCTGGGAAGG - Intronic
1086255835 11:84875235-84875257 TCAAAGTGAAAATGCTGAGAAGG + Intronic
1086493685 11:87380868-87380890 TCATGGAGAAACTGGTGGCAGGG + Intergenic
1086575176 11:88331467-88331489 ACATAGAGCAAGTTCTGGAAGGG + Intronic
1086920276 11:92578874-92578896 TCATAAAAAAAATGCTGGAAAGG + Intronic
1087016006 11:93555278-93555300 TGGTAGAGAAAATGTTGGAAAGG - Intergenic
1088066239 11:105723476-105723498 TCAATGAGATAATGTTGGAAAGG + Intronic
1088134579 11:106539168-106539190 TTATAAAGAAAATGATGCAAAGG - Intergenic
1088166429 11:106943877-106943899 TCAGAGAGACAATGTTTGAAGGG + Intronic
1088296910 11:108308537-108308559 GCATACAGAAATTGCTAGAATGG + Intronic
1088648732 11:111938590-111938612 TTCTGGAGAAAAGGCTGGAATGG - Intronic
1091015834 11:132050124-132050146 TTAGAGAGAAAATGCTGGCAGGG + Intronic
1091682076 12:2534273-2534295 TCAGAGGGCGAATGCTGGAAAGG + Intronic
1095158691 12:38889877-38889899 GCATAGAGAAAATGATGGGGAGG + Intronic
1095394146 12:41743283-41743305 TCATATTGAAAATGCTGGGAGGG + Intergenic
1095844205 12:46728682-46728704 GCATTGAGAGAATGGTGGAATGG - Intergenic
1097539708 12:60924727-60924749 TCAAAGAGTACAAGCTGGAAAGG - Intergenic
1097775962 12:63646159-63646181 TCATAGAGCTTATGCTGTAAGGG - Intronic
1098079571 12:66769705-66769727 TTATAGTGAACTTGCTGGAAAGG - Intronic
1098499150 12:71170360-71170382 TCAAAGAGTAAATGCTTGAGGGG + Intronic
1098571541 12:71993089-71993111 TCATAGAGAGAAGGTTGAAAGGG - Intronic
1098797343 12:74907346-74907368 TCATGGAGAAAATGTAGCAAGGG + Intergenic
1099669618 12:85673704-85673726 CCTTAGAGTTAATGCTGGAATGG - Intergenic
1100049673 12:90432474-90432496 ACAGAGAGAATATGCTGGACTGG - Intergenic
1100702019 12:97159159-97159181 TCATAGAGAACAAAATGGAAAGG - Intergenic
1100769575 12:97906762-97906784 TCATAGAGAAAATGTAGATAGGG - Intergenic
1102740597 12:115204050-115204072 TCAGAGAGAAAATGAAGGCATGG - Intergenic
1103286998 12:119810793-119810815 TCTGAGAGAAAAGGCTGCAATGG + Intronic
1104104517 12:125646294-125646316 GGATAGAGAAAATTTTGGAAGGG + Intronic
1105830862 13:24161839-24161861 GGACAGAGAAAATGCTGGCAGGG - Intronic
1106406674 13:29480633-29480655 TGACAGAGAAAAGTCTGGAAGGG - Intronic
1107290087 13:38842088-38842110 CCATAGAGCAAAGGCTGGGAGGG + Intronic
1107347723 13:39480567-39480589 TCTTAGAGAAAATGCCATAATGG + Intronic
1107596680 13:41970506-41970528 TAATAGAGAAAAGGCTATAAAGG - Intergenic
1107993509 13:45838953-45838975 TGAAAAAGAAAATGTTGGAAGGG + Intronic
1108802108 13:54111227-54111249 TCATAGAAAAAATTCTATAAGGG + Intergenic
1109112243 13:58336044-58336066 TCAAAGAGCAAATGCTTGAGGGG - Intergenic
1109452758 13:62539778-62539800 ACAGAGAGAAAATACTGGAGAGG - Intergenic
1109478989 13:62923155-62923177 TCACAGTGATAATGGTGGAATGG + Intergenic
1109664406 13:65513454-65513476 TCATACAGAAAATGGTGAACAGG + Intergenic
1110033467 13:70648813-70648835 GCCTATAGAATATGCTGGAAAGG - Intergenic
1111835244 13:93380042-93380064 TCAGTGGGAAAATGCTGGTAAGG + Intronic
1112369579 13:98782995-98783017 GAAGACAGAAAATGCTGGAATGG + Intergenic
1113195263 13:107796724-107796746 TCATGGAGAATAAGTTGGAATGG - Intronic
1114366984 14:22039253-22039275 TAATAGAGAAAATTTTGAAATGG + Intergenic
1115071207 14:29323606-29323628 TCAAAGAGAAAATGCCAGCAAGG + Intergenic
1116101894 14:40449283-40449305 TCATAGAGCAATTTCTAGAAAGG - Intergenic
1116305347 14:43246804-43246826 TCATAGAGAAAATTGTCAAAAGG + Intergenic
1116561598 14:46386322-46386344 TCATAGGAAAAAGTCTGGAAGGG + Intergenic
1116598292 14:46882778-46882800 TCATAGTGGGAAGGCTGGAAAGG + Intronic
1117030525 14:51664616-51664638 TAATTTAGAAAATGCCGGAAAGG + Intronic
1117596633 14:57332539-57332561 TCATCGAGAGAAGGCAGGAAAGG + Intergenic
1117781399 14:59236459-59236481 CCAGAGAGCAAATGCTTGAAGGG - Intronic
1118011470 14:61614723-61614745 TTATGAAGAAAATGCTGGAAGGG - Intronic
1118539723 14:66808888-66808910 TCATGGAGAACATGATGGGAAGG + Intronic
1118713623 14:68543296-68543318 TCATGGAGAAAAAGCTAGGATGG - Intronic
1118995254 14:70829856-70829878 TCATATTGGAAAGGCTGGAATGG - Intergenic
1119123537 14:72101896-72101918 TAATAGAGAAGAGGATGGAAAGG - Intronic
1119259565 14:73229573-73229595 TCACAGAGACAGAGCTGGAATGG - Intergenic
1120254545 14:82102599-82102621 TCATAGAGAAACTGGTGGACTGG + Intergenic
1120763072 14:88303466-88303488 TCACAGCAAAATTGCTGGAAAGG - Intronic
1122250523 14:100436193-100436215 TCATATGGAAAATGCTGGATGGG - Intronic
1122444236 14:101757630-101757652 TCACAGAGAAGACGCAGGAAGGG + Intergenic
1125377146 15:39042283-39042305 TCAGAGGGAAAAGGCTGGAGGGG + Intergenic
1126391486 15:48159777-48159799 TGATGGAGAAAATGCTCGTAGGG - Exonic
1127277362 15:57459060-57459082 TCAGAGACACAATTCTGGAATGG + Intronic
1127744629 15:61954139-61954161 TCATATAAGAAATGCAGGAAAGG - Intronic
1128700513 15:69800953-69800975 TGAGGGAGAATATGCTGGAACGG - Intergenic
1129543687 15:76372905-76372927 TCATAGAAAAGAGGCTGGAGGGG + Intronic
1130369703 15:83274567-83274589 TCAAAAAGCAGATGCTGGAAGGG - Intronic
1130675594 15:85949254-85949276 CTAAAGTGAAAATGCTGGAAAGG - Intergenic
1131022588 15:89111909-89111931 CCCTAGAAAAAATGATGGAAAGG - Intronic
1131292545 15:91119107-91119129 ACATAAATAAAATGCTGGCAGGG + Intronic
1131301820 15:91206373-91206395 ACATGGAGAACCTGCTGGAAGGG - Intronic
1135482047 16:22828819-22828841 TGCTAGAGAAAATACAGGAAAGG - Intronic
1135518459 16:23155127-23155149 TTACAGACAAAATTCTGGAAGGG - Intergenic
1137447002 16:48538092-48538114 CCAGTCAGAAAATGCTGGAAGGG - Intergenic
1137710309 16:50562322-50562344 GCATAGAGAAAGATCTGGAAGGG + Intronic
1139114409 16:63932172-63932194 TAATAGACAAAAGGCAGGAATGG - Intergenic
1139287022 16:65824770-65824792 TCATACAGAAAATGTTGACAGGG + Intergenic
1143303497 17:5928233-5928255 ACCAAGAGAACATGCTGGAAAGG - Intronic
1146164371 17:30576455-30576477 ACAAAGAGAAAATGGCGGAATGG - Intergenic
1148488105 17:48004203-48004225 TCACAGAGGAGATGCTGAAAGGG - Intergenic
1148739278 17:49883109-49883131 GAAAAGAGAAAATTCTGGAAAGG + Intergenic
1149390302 17:56183267-56183289 ACATTGACAAAATTCTGGAAAGG + Intronic
1150176621 17:63063843-63063865 TTATAGAGAAAATCGTGAAAAGG - Intronic
1150846826 17:68666965-68666987 TCAAAAAGTAAATGCTGGCAAGG - Intergenic
1154090931 18:11362363-11362385 TCAAAGTGAAAATGCTGGCCAGG - Intergenic
1154930508 18:20990298-20990320 TCATAAAGAAAATCAAGGAAAGG + Intronic
1156073003 18:33236716-33236738 TCAAAGAGAGAATGCTGGAGTGG + Intronic
1159355657 18:67335285-67335307 TCATAGATATAAAGCTTGAATGG - Intergenic
1160376887 18:78420431-78420453 ACATCATGAAAATGCTGGAAAGG - Intergenic
1164833714 19:31342846-31342868 ACACAGAGAAACTGGTGGAAGGG + Intronic
1165193518 19:34083098-34083120 TGAAGGAGAAAATGATGGAAAGG + Intergenic
1168498495 19:56874128-56874150 TCAGTGAGAAAATGTTGGCATGG + Intergenic
1168530063 19:57120121-57120143 TCAAACAGAAAATGCTGGCCAGG + Exonic
925683384 2:6446615-6446637 TTATAACTAAAATGCTGGAAGGG + Intergenic
925851901 2:8089993-8090015 ACAAAGAGAAAATGCTTGAGTGG - Intergenic
927481822 2:23459934-23459956 TCATGGTGAAACTTCTGGAAAGG - Intronic
928180058 2:29062559-29062581 TCATGGAGAACACGCAGGAAGGG - Exonic
928915855 2:36469517-36469539 TCTTAGAGAAAATTCTGTCAGGG - Intronic
929931117 2:46256289-46256311 TTATAGAAAAATTGGTGGAAAGG - Intergenic
932208918 2:69910784-69910806 TTAAAAAGAAAATGCTGTAAGGG + Intronic
932254389 2:70271479-70271501 TCATATTTAAAATGCTTGAAAGG + Intronic
936442447 2:112566452-112566474 ACATAGAAAAAATGCTGGTGGGG - Intronic
936473741 2:112821985-112822007 TCTGAGAGGAAATGCTGGAGAGG + Intergenic
937071177 2:119064910-119064932 TGTTAGAGAAGATGCTCGAAAGG - Intergenic
937285519 2:120748474-120748496 TCATAGGGCAAGTGCTGGACAGG + Intronic
937401327 2:121586571-121586593 GCATAGAGAAAAATCTGGTATGG - Intronic
938304107 2:130238892-130238914 TGATAGAAAAAAAGCTGAAAAGG - Intergenic
938452577 2:131435394-131435416 TGATAGAAAAAAAGCTGAAAAGG + Intergenic
938990051 2:136618558-136618580 GCATGGAGAAAATACTGGAGAGG - Intergenic
938990644 2:136625276-136625298 TAATAGAGAAAATGCTCATAAGG + Intergenic
939108675 2:137980578-137980600 ACTTAGAGAAAATGCTTCAAAGG - Intronic
939607081 2:144266170-144266192 TACTGGAGAAAATGATGGAAAGG + Intronic
939632276 2:144539221-144539243 TCAGAGAGAAAATGTTTTAAGGG - Intergenic
939786128 2:146515487-146515509 TCTTAGAGAAATGGCTGGTAGGG - Intergenic
941216803 2:162720929-162720951 TGATAGAGAAAATGCTAATAAGG - Intronic
941237316 2:162991176-162991198 TCATTTAGAAAAGGTTGGAAAGG - Intergenic
941287445 2:163631603-163631625 TGATACGGAAAATGGTGGAAAGG - Intronic
941508731 2:166378909-166378931 TCACAGGGAAAATCCTGCAAGGG - Intergenic
941995618 2:171599549-171599571 TCTTAGTGCAAATGCTGGGACGG - Intergenic
942856135 2:180551244-180551266 ATATAGAGAAAATACTGGCAGGG + Intergenic
943112958 2:183628991-183629013 TTATACAGGAAATGTTGGAAGGG - Intergenic
943148415 2:184076547-184076569 TCAAAGAAAAAAGGCTTGAAGGG + Intergenic
944015100 2:195026532-195026554 TCATAGCTAAGTTGCTGGAATGG - Intergenic
944093217 2:195936745-195936767 CCATTGACAGAATGCTGGAAAGG - Exonic
944758407 2:202787901-202787923 TCATGGAGAAAACACTGGATTGG + Intronic
945276492 2:207992746-207992768 TAATTGAGAAAAATCTGGAAAGG + Intronic
945282656 2:208050560-208050582 TCATAAAGCAAATGCTGGTGTGG + Intergenic
945935544 2:215899614-215899636 TCGTGGAAAAAATTCTGGAAAGG + Intergenic
947997813 2:234543684-234543706 TCAGAGAGAAAATGGTAGACGGG + Intergenic
948089549 2:235281060-235281082 TCTCAGATAACATGCTGGAAGGG + Intergenic
948414768 2:237795066-237795088 TAATGTAGAAAATGCAGGAAAGG - Intronic
948927714 2:241110257-241110279 TCATAGAGAAAATAGCAGAATGG + Intronic
1169020007 20:2323209-2323231 TCAGAGAGAAAAGGTGGGAAGGG - Intronic
1169667616 20:8055532-8055554 TCATGGAGACAATGCTGACATGG - Intergenic
1171061958 20:21973537-21973559 TTACAGAGAAAATCCTGGGATGG - Intergenic
1173129078 20:40370742-40370764 CAAGAGAGAAAGTGCTGGAATGG - Intergenic
1174978824 20:55368276-55368298 TCATTTAGAAAATGGTGGAAAGG - Intergenic
1175658383 20:60791770-60791792 TTATAGAGGAGATGCAGGAATGG - Intergenic
1177077852 21:16600002-16600024 TTCTAGAGAAAGTGATGGAAGGG + Intergenic
1177133090 21:17280484-17280506 TCATAGAGATATTGCTTTAATGG - Intergenic
1177572716 21:22908312-22908334 TCAGAGAGAAAATGGAAGAAAGG + Intergenic
1177680500 21:24362820-24362842 GCATAGAGAAAATGGGGGAGTGG + Intergenic
1177888683 21:26778274-26778296 TTAAAGAGAAAATACAGGAATGG - Intergenic
1178005862 21:28219146-28219168 GCATTGAGAGAATGGTGGAATGG - Intergenic
1178051981 21:28757920-28757942 TTACTGAGAAAATGATGGAATGG - Intergenic
1178239028 21:30877758-30877780 TCTTAGTGAAAATCATGGAAAGG + Intergenic
1178578241 21:33814381-33814403 TCAGACAGAAACTGCTGGGAAGG + Intronic
1178579322 21:33824510-33824532 TGAGAGAGAAAAGGCTGGCAGGG + Intronic
1178678190 21:34648649-34648671 TCATAGAGAAATTACTGGTGTGG + Intergenic
1179777480 21:43675504-43675526 AAATAGACAAAAGGCTGGAAAGG + Intronic
1181639613 22:24189726-24189748 TCTCAGAGAAAGTGCTGGAGAGG + Intergenic
1181969988 22:26682643-26682665 TGAGATGGAAAATGCTGGAAGGG - Intergenic
1182581936 22:31319110-31319132 GCATAGAAAAAAGACTGGAAGGG - Intergenic
949112974 3:285324-285346 TTATAGAGAAAATGGTGGGAGGG - Intronic
949217159 3:1583632-1583654 TCCTGGAGTCAATGCTGGAAGGG + Intergenic
949746165 3:7294522-7294544 GCATAGAGAAAAGGAAGGAAAGG - Intronic
949822211 3:8127618-8127640 GCAGAGAGAGAATGTTGGAAGGG - Intergenic
950954399 3:17036079-17036101 TCATAGTGACCTTGCTGGAAGGG + Intronic
951786601 3:26426889-26426911 TACTAAAGAAAATGCTAGAATGG + Intergenic
951838609 3:27009144-27009166 TCAAGGAGAAAATCCTTGAAAGG + Intergenic
952077360 3:29713385-29713407 TCAAAGAGAAAAGTCTGTAATGG + Intronic
952598261 3:35045062-35045084 TCATAGGGAAAATAGTAGAATGG + Intergenic
952611403 3:35215221-35215243 TCATTTATAAAATGCTTGAAGGG - Intergenic
953544529 3:43854645-43854667 TTATAGAATAAATGCTTGAAAGG + Intergenic
953601241 3:44366975-44366997 TCATAGAGAAAATTCAAGATGGG + Intronic
957962273 3:87271600-87271622 TCATAATCAAAATGCTGTAAAGG + Intronic
958623185 3:96589293-96589315 GAAGAAAGAAAATGCTGGAAAGG + Intergenic
959139214 3:102464851-102464873 TCAGATAAAAAATGCTGAAAAGG - Intronic
959968275 3:112380482-112380504 TTATAGAGGAAAAGCTGTAATGG - Intergenic
960855971 3:122102571-122102593 CCATAGACATCATGCTGGAAGGG - Intronic
961809451 3:129513561-129513583 TCAAACAGAACTTGCTGGAAAGG - Intronic
963080770 3:141391752-141391774 TCAAAGGCAAAATGGTGGAAGGG + Intronic
963189924 3:142458323-142458345 TCAGAGATAAAATACTGGCATGG - Intronic
963321535 3:143814396-143814418 TCAAGGACAGAATGCTGGAAGGG + Intronic
963551046 3:146723252-146723274 ACAAATAGCAAATGCTGGAAAGG - Intergenic
963736891 3:149027960-149027982 TCATAGATAAAATACTAGTAGGG - Intergenic
964360531 3:155891379-155891401 TTATAGAGAAAATCCATGAAGGG + Intronic
965038595 3:163474951-163474973 TCATAAAGACAATGGTGCAAAGG - Intergenic
965051029 3:163647904-163647926 ACATAGAAAGAATGCAGGAAAGG + Intergenic
965477936 3:169180751-169180773 ACATAAAGAGAATACTGGAAAGG - Intronic
965496636 3:169406374-169406396 TCATAGAATATAAGCTGGAAAGG - Intronic
965774679 3:172216079-172216101 AAAGAGAGAAAATGCTGGGATGG + Intronic
965776211 3:172234089-172234111 TCAAAGAGAAAATGCAGAACAGG - Intronic
965946562 3:174249168-174249190 TCATAGAAAAGATGGGGGAAGGG - Intronic
965960650 3:174424985-174425007 TCATGGAGAAAATTCTGGGAGGG - Intergenic
965976643 3:174632482-174632504 TACAAGATAAAATGCTGGAATGG + Intronic
966122937 3:176543722-176543744 TACTAGAGAAGATTCTGGAAGGG - Intergenic
966235567 3:177698132-177698154 TCAAAGTGTAAATGCTTGAAGGG + Intergenic
966391938 3:179462069-179462091 CCATAGAGATAAAGCTAGAAAGG - Intergenic
966502195 3:180655717-180655739 TGAAAGAGATAAAGCTGGAAAGG + Intronic
967160053 3:186727908-186727930 GAATAGATAAAATGCTTGAACGG + Intronic
967333992 3:188322156-188322178 CCATAGATTAAATGTTGGAAAGG - Intronic
970456827 4:16231782-16231804 TCTTAGAGATAAATCTGGAATGG - Intergenic
970469827 4:16366564-16366586 TCATGGAGAAAATGTGGGAAGGG - Intergenic
971382899 4:26116126-26116148 ACAAACAGAAAATGTTGGAATGG - Intergenic
971481576 4:27119370-27119392 TCACAGAGAAAGTCATGGAATGG - Intergenic
971605029 4:28648016-28648038 TCATGGAGAGGATGGTGGAAAGG - Intergenic
971821786 4:31566400-31566422 ACATATAGCAAATGCTGGCAAGG + Intergenic
972065004 4:34931120-34931142 TCATAGAGAAAAGAGTAGAATGG + Intergenic
972722331 4:41712757-41712779 CCATAGAATAAATGTTGGAAAGG - Intergenic
972892248 4:43573196-43573218 TAATAGAGAAAAAGCAGAAAAGG - Intergenic
973813358 4:54594919-54594941 TCACAGAAAAACTGCTTGAACGG - Intergenic
974453484 4:62095872-62095894 TTATAGTTAAAATGTTGGAAAGG + Intergenic
975385885 4:73759906-73759928 TCATATAGAAAAAGCAGAAATGG + Intergenic
976439674 4:85058848-85058870 TCATAGAGAAAACCATGAAATGG + Intergenic
976986549 4:91307336-91307358 TCATAGAAAAAGTTCTTGAAAGG - Intronic
978040533 4:104055546-104055568 TCATTGAGAAAATGGTTAAAAGG - Intergenic
978709682 4:111764433-111764455 GCATAGAGAACATGCTGGGGTGG + Intergenic
979992238 4:127389079-127389101 ACAGAGAGATAATGCTTGAAGGG + Intergenic
983081695 4:163393120-163393142 TCATAGAGAAAATGTAGCTAAGG + Intergenic
983717220 4:170797894-170797916 TCATAGAGAAGTTGCTGAAAAGG + Intergenic
984524196 4:180837287-180837309 TCCTGGAGAAAATGTGGGAAGGG - Intergenic
984639852 4:182150305-182150327 ACATACAGAAAATGCTCAAAGGG - Intronic
984692359 4:182741476-182741498 TCATAGAGAAGAAGCAGGAAGGG + Intronic
984721055 4:182973473-182973495 CCATACTGAAAATCCTGGAATGG + Intergenic
985241368 4:187933977-187933999 TGATAGAGAGGATGATGGAAGGG + Intergenic
986559945 5:9050331-9050353 TTATAGAAAACATGCAGGAAGGG + Intronic
986831200 5:11580642-11580664 TCATTGAGAAACTGCTGGAAAGG - Intronic
988238994 5:28583780-28583802 GTATAGAGAAAATGATTGAAAGG + Intergenic
988625070 5:32866150-32866172 TCATTTATAAAATGCTGGAGTGG + Intergenic
989015186 5:36922914-36922936 TTACAGAGATAATACTGGAAAGG - Intronic
989813939 5:45712533-45712555 TCTGAAAGAACATGCTGGAAAGG - Intergenic
991020927 5:61979697-61979719 GCATAGAGAAAGTGCTGGAAGGG - Intergenic
991472783 5:66986532-66986554 ACAGAGAGAAAGTACTGGAAAGG - Intronic
992008859 5:72507553-72507575 TCTTAAACAAAATGTTGGAAGGG + Exonic
992791373 5:80217312-80217334 TCATGGAGATTATGCTGCAAGGG + Intronic
992912739 5:81414024-81414046 TCCTAGAAAAAATGATGTAAAGG - Exonic
994188999 5:96846715-96846737 TGGTGGAGAAAATGCTGGGAGGG - Intronic
994313718 5:98307627-98307649 TCACAGAGCAAAAGTTGGAAGGG - Intergenic
995215897 5:109594066-109594088 GCATTGAAAAAATACTGGAATGG - Intergenic
995968522 5:117939196-117939218 TCAAAAATAAAATGCTGAAAAGG - Intergenic
998765324 5:145480006-145480028 TTATAGTTAAAAAGCTGGAAAGG - Intronic
999176142 5:149632973-149632995 TCATAGAGGAAACTCTGGGAAGG + Exonic
999812965 5:155145486-155145508 GCAGAGTGAAAATCCTGGAAGGG + Intergenic
999881262 5:155867045-155867067 TTCTAGAGAAAATGATGGAGAGG + Intergenic
1001760566 5:174204674-174204696 TCATAGAGACTATGCTGTGACGG + Intronic
1001889266 5:175325536-175325558 GCATAGAAAAAATGTTTGAAAGG - Intergenic
1002656213 5:180749835-180749857 GCATAAAGAAAAGGATGGAAAGG + Intergenic
1002714395 5:181217458-181217480 TCTCAGGGAAAATGCTGCAAAGG - Intergenic
1004201380 6:13551321-13551343 ACACAGAGAAAATGAAGGAAAGG - Intergenic
1004478350 6:15995197-15995219 TCATTGAGAAAGATCTGGAATGG + Intergenic
1004626960 6:17385898-17385920 TGATAGAGATAATCCTGGATGGG + Intergenic
1005257997 6:24024753-24024775 TCAGAGAGAAATTGGTTGAAAGG + Intergenic
1005595367 6:27374247-27374269 TGATAGATAAAAGGCTGGAGTGG + Intergenic
1007225869 6:40313773-40313795 TCACAGATAAAATGCTGACAGGG - Intergenic
1007974000 6:46081931-46081953 TCATAGAGAAATATCTGAAAAGG - Intergenic
1008216009 6:48789761-48789783 TCATAAATGAAATGCTAGAAAGG + Intergenic
1008747940 6:54695844-54695866 TCATCATGACAATGCTGGAAAGG + Intergenic
1009849209 6:69173899-69173921 TAATGGAGAACATGCAGGAATGG + Intronic
1010279225 6:74004692-74004714 TCAGAGAGAGAATGCAAGAAAGG + Intergenic
1011136189 6:84103671-84103693 TCTTGGAGAAAAGTCTGGAATGG - Intergenic
1011208804 6:84932017-84932039 TCACAGAGAAAACACTGGAATGG - Intergenic
1013296782 6:108764706-108764728 TCCCAGAGACAGTGCTGGAAAGG - Intergenic
1013450649 6:110277028-110277050 AAATAGAAAAAATGTTGGAATGG - Intronic
1013884148 6:114941385-114941407 TCATAGAGGAAATGCAGGAGAGG - Intergenic
1015484666 6:133755197-133755219 TCAGAAAGGAAATGTTGGAAAGG + Intergenic
1015576708 6:134679358-134679380 GCATATAGAAGATTCTGGAAAGG - Intergenic
1017150999 6:151280391-151280413 TCATATAGAAAAGGGTGGAAGGG - Intronic
1018280492 6:162180312-162180334 TCAAAGAAAAAATGCTTGAGGGG + Intronic
1020644241 7:10794752-10794774 TCATTGAGACTATTCTGGAATGG + Intergenic
1021163331 7:17302121-17302143 TCATAAAGAAAAAGTTGTAATGG + Intronic
1021663763 7:22950784-22950806 TTATATAGAAGATGCTGTAAGGG + Intronic
1021900446 7:25279832-25279854 TCAGTAAGAGAATGCTGGAAAGG + Intergenic
1022240424 7:28506316-28506338 TTATAAAGAGAATGCAGGAATGG + Intronic
1022300953 7:29101762-29101784 CCATAGAGAAAAATCTGGAAGGG - Intronic
1022697617 7:32725276-32725298 TCATAGAGTTTATGCTGTAAGGG - Intergenic
1022934861 7:35163754-35163776 TCATAGAGTTTATGCTGTAAGGG - Intergenic
1023060172 7:36319156-36319178 TCAAAGATAAACTGCTGGAAGGG + Intergenic
1024232488 7:47373220-47373242 ACACAGAGTAAATGGTGGAATGG - Intronic
1024686921 7:51755988-51756010 GCATAGTCAAAATGCTGCAAGGG - Intergenic
1024802808 7:53100532-53100554 TCATAGGAAGATTGCTGGAAGGG - Intergenic
1024979889 7:55148386-55148408 CCACAGAGAAAGTGCTGGAAAGG + Intronic
1025090011 7:56054291-56054313 CCACAGACAAAATGCAGGAAGGG - Intronic
1026372904 7:69719441-69719463 TCATACAGAAAAAGCTGGTAAGG + Intronic
1026736630 7:72953198-72953220 AGATGGAGAAACTGCTGGAAAGG + Intergenic
1027107104 7:75411865-75411887 AGATGGAGAAACTGCTGGAAAGG - Intergenic
1027290997 7:76710737-76710759 ACATAGAAAAAATGCTTAAATGG - Intergenic
1028548408 7:92028490-92028512 TAATAAAGAAAAAGCAGGAAAGG + Intronic
1028635415 7:92983944-92983966 TGAAAGAGAAAAAGCAGGAAAGG - Intergenic
1028841387 7:95433496-95433518 TTATAGAGATAAGCCTGGAAGGG - Intronic
1029830807 7:103256518-103256540 TCATAGAGTTTATGCTGTAAGGG - Intergenic
1030425491 7:109371992-109372014 TAATAGAGTAAAAGCTGGAGGGG + Intergenic
1031177785 7:118374508-118374530 TCAGTGAAAAAATCCTGGAATGG + Intergenic
1031491682 7:122397427-122397449 ACAAAGAGAAAATGATGGAGGGG + Intronic
1032141128 7:129330867-129330889 TCATAGATAAAGGTCTGGAAGGG + Intronic
1033176188 7:139126021-139126043 TTATATAGAAAATGCTGGCCGGG + Intergenic
1033311438 7:140264791-140264813 TCCTAGAGAAAGTGCTGGAAAGG - Intergenic
1034377681 7:150660192-150660214 TCATAGAGAGAATTCAGAAAAGG - Intergenic
1035713333 8:1735236-1735258 TCATAGGGAAATGGCTGGATCGG - Intergenic
1036533153 8:9616266-9616288 GCAAAGAGGAAATGCTAGAATGG + Intronic
1037347743 8:17917458-17917480 TCATAGGAAAAATGTTAGAAAGG - Intergenic
1037724541 8:21472477-21472499 AGAAAGAGAAAATGTTGGAAGGG + Intergenic
1037751583 8:21685833-21685855 GTATAGAGAAAAGGCTGGCAGGG - Intergenic
1038975790 8:32694357-32694379 ACATACAGAACATTCTGGAAAGG - Intronic
1039209052 8:35190925-35190947 TCATAAAGATTATGCTGAAATGG - Intergenic
1039250815 8:35662091-35662113 TCATAGAGAAAATGCTGGAATGG - Intronic
1039280955 8:35983974-35983996 TCAAAGGGTAAATGCTTGAAAGG - Intergenic
1039299440 8:36193799-36193821 CCAGAGAGAGAATGCTGGGAGGG - Intergenic
1039565538 8:38549695-38549717 TCAGAGAAAAAATGATGAAATGG - Intergenic
1040516616 8:48140919-48140941 ACATAGAAAAAGTTCTGGAAGGG + Intergenic
1042037094 8:64545653-64545675 TAAGAAAGATAATGCTGGAAAGG - Intergenic
1042613115 8:70619391-70619413 TCCTAGAGAACATGGTGTAAAGG + Intronic
1043186870 8:77163499-77163521 ACATAAAGAAAATGCTGGAAAGG - Intergenic
1043700182 8:83277006-83277028 TCATAGAGAGAGAGGTGGAATGG - Intergenic
1043774302 8:84245512-84245534 TCAAATAGAAAATGCTTGAAAGG + Intronic
1044123170 8:88423703-88423725 TCTAAGAGAAAAAGATGGAATGG - Intergenic
1045025418 8:98082143-98082165 AAATAGGGAAAATGCTAGAAGGG - Intronic
1045026924 8:98096551-98096573 TCATAGAGAAACTGCCAGCAGGG + Intergenic
1046718732 8:117595503-117595525 TCAGGGATAAAAAGCTGGAAAGG + Intergenic
1048666243 8:136664649-136664671 TCAAAGAGCAAAAGTTGGAAAGG + Intergenic
1049145355 8:140996965-140996987 ACATAGAAAACATGCTGGAAAGG + Intronic
1049264772 8:141661713-141661735 TCATAAAGAAATAGCTGGACGGG + Intergenic
1050585535 9:7107756-7107778 TTATAGAGAAAACGCTGTATTGG + Intergenic
1051516136 9:17932299-17932321 TCTTGGAGAAATTGATGGAAAGG - Intergenic
1051572870 9:18580810-18580832 TCACAGTGAAAATTCTGGAAGGG - Intronic
1052458631 9:28733651-28733673 TGATAGAGAAAAAGGTGGACTGG - Intergenic
1052702840 9:31959462-31959484 TCAAAGACTAAAGGCTGGAATGG - Intergenic
1053507935 9:38660823-38660845 TAATAAAGAAAATGCTTAAAGGG - Intergenic
1055561511 9:77526254-77526276 TCTTAGAGTTGATGCTGGAATGG + Intronic
1056086267 9:83152372-83152394 TCAAAGATAAAGAGCTGGAAGGG + Intergenic
1057495134 9:95554537-95554559 TCCTAGAGAAAGGACTGGAAGGG - Intergenic
1057725292 9:97564095-97564117 ACGTAGAGGAAACGCTGGAACGG + Exonic
1057756798 9:97845702-97845724 TCATTGATAAAATGCTGGACAGG + Intergenic
1057949329 9:99357217-99357239 GCATGTAGAAAATGCTGGAATGG - Intergenic
1058382510 9:104392850-104392872 TCAGACTGAAAATTCTGGAATGG - Intergenic
1058641229 9:107087598-107087620 GCACAGATAAAATGTTGGAAAGG + Intergenic
1058845323 9:108951554-108951576 TCCTTGAGAAAATTCTAGAAGGG + Intronic
1059739257 9:117133773-117133795 TCACAGAGAAAATGGTTTAAAGG + Intronic
1060409092 9:123388324-123388346 TCATAGAAAAAAGACTGGAAAGG + Intronic
1060463008 9:123876318-123876340 TCATAGGGAAAATGCTGTAAAGG + Intronic
1061225106 9:129276842-129276864 TCCAAGGGAATATGCTGGAAGGG - Intergenic
1185920138 X:4082458-4082480 TTATGCAGAAAATGCTGGAAAGG - Intergenic
1186280184 X:7984591-7984613 TCAATGAGAAAAGGCTGTAAAGG - Intergenic
1186353209 X:8761409-8761431 TCAATGAGAAAAGGCTGTAAAGG + Intergenic
1186624942 X:11283405-11283427 TCATAGAGAAAAATCTTGGAAGG - Intronic
1187701640 X:21969141-21969163 TTATAGAGAGAATAGTGGAAGGG - Intronic
1188056577 X:25548101-25548123 TCACAGAGAAAATGCTCAAAAGG - Intergenic
1188403444 X:29776434-29776456 TTATAAAGTAAATGCTGAAAAGG - Intronic
1188411650 X:29879560-29879582 GCATAGAGAAAAAGCTGGAAGGG + Intronic
1189165548 X:38857487-38857509 TCACAGAAAATATGATGGAATGG - Intergenic
1189828826 X:44949432-44949454 GCATAGAGAAAAGTCTGAAAGGG + Intronic
1189989726 X:46582834-46582856 ACATAGAGAAAATGTATGAATGG - Intronic
1190686082 X:52875098-52875120 GCATAGAAAAAAGCCTGGAAGGG + Intergenic
1192331865 X:70182162-70182184 AAATAGAGAAAATGGAGGAAAGG + Intronic
1193780266 X:85692997-85693019 TCAAGGAGAAAATGCTGTAAAGG + Intergenic
1194244445 X:91493698-91493720 TGATGGAGAAAATGCCTGAAAGG - Intergenic
1195078744 X:101351486-101351508 TCACAGAGAAAGTGCAGAAAGGG - Intronic
1195171673 X:102274649-102274671 TCAAAGAATAAATGCTTGAAGGG - Intergenic
1195187187 X:102412444-102412466 TCAAAGAATAAATGCTTGAAGGG + Intronic
1195588170 X:106590889-106590911 TTATAGAGAATATCTTGGAAAGG + Intergenic
1196539319 X:116886165-116886187 TGATATAGAAAATGCTAGATAGG + Intergenic
1197196462 X:123707176-123707198 ACATACAGAAAAAACTGGAAAGG - Intronic
1197873311 X:131080522-131080544 TAATAGAGAATGTGCGGGAAAGG + Intronic
1198390630 X:136170300-136170322 GCATGGAGCAAATGCTGGGATGG + Intronic
1198466204 X:136906948-136906970 ATATACAGAATATGCTGGAATGG + Intergenic
1198797686 X:140416332-140416354 TCAGAGGGAAAATGCTGGTATGG + Intergenic
1199034362 X:143033062-143033084 AAATAGAGAAAAATCTGGAAAGG + Intronic
1199362044 X:146932145-146932167 TCTTAGAGAAAATAGAGGAAAGG + Intergenic
1199552182 X:149072434-149072456 TCAAAGAGTAAAGGCAGGAATGG + Intergenic
1200397437 X:155999429-155999451 TCATAGAGAAGGTGCAGGGAAGG - Intronic
1201667201 Y:16471857-16471879 TCCAAGAGAAAAAGCTGGAAAGG - Intergenic
1201708426 Y:16962548-16962570 TGGTAGATAAAATGGTGGAAAGG - Intergenic
1202019248 Y:20448207-20448229 TCAGAAATAGAATGCTGGAAGGG - Intergenic