ID: 1039251394

View in Genome Browser
Species Human (GRCh38)
Location 8:35668808-35668830
Sequence CTTCTTGTTGAAATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039251390_1039251394 15 Left 1039251390 8:35668770-35668792 CCTTTAAACTGATTTTAATTAAC 0: 1
1: 0
2: 4
3: 38
4: 407
Right 1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039251394 Original CRISPR CTTCTTGTTGAAATGGAGCC TGG Intronic
No off target data available for this crispr