ID: 1039251394 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:35668808-35668830 |
| Sequence | CTTCTTGTTGAAATGGAGCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039251390_1039251394 | 15 | Left | 1039251390 | 8:35668770-35668792 | CCTTTAAACTGATTTTAATTAAC | 0: 1 1: 0 2: 4 3: 38 4: 407 |
||
| Right | 1039251394 | 8:35668808-35668830 | CTTCTTGTTGAAATGGAGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039251394 | Original CRISPR | CTTCTTGTTGAAATGGAGCC TGG | Intronic | ||
| No off target data available for this crispr | |||||