ID: 1039253225

View in Genome Browser
Species Human (GRCh38)
Location 8:35689616-35689638
Sequence GGCCCAGTTGGAAGGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039253213_1039253225 30 Left 1039253213 8:35689563-35689585 CCCAGTTCAAGCCCAAAAGTTGG 0: 1
1: 0
2: 2
3: 5
4: 97
Right 1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG No data
1039253218_1039253225 18 Left 1039253218 8:35689575-35689597 CCAAAAGTTGGTAGGCTGCTATG 0: 1
1: 0
2: 0
3: 10
4: 76
Right 1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG No data
1039253222_1039253225 -8 Left 1039253222 8:35689601-35689623 CCAGGAACATCTGATGGCCCAGT 0: 1
1: 0
2: 1
3: 13
4: 142
Right 1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG No data
1039253217_1039253225 19 Left 1039253217 8:35689574-35689596 CCCAAAAGTTGGTAGGCTGCTAT 0: 1
1: 0
2: 0
3: 3
4: 152
Right 1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG No data
1039253215_1039253225 29 Left 1039253215 8:35689564-35689586 CCAGTTCAAGCCCAAAAGTTGGT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1039253225 8:35689616-35689638 GGCCCAGTTGGAAGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039253225 Original CRISPR GGCCCAGTTGGAAGGCTGTC AGG Intronic
No off target data available for this crispr