ID: 1039254925

View in Genome Browser
Species Human (GRCh38)
Location 8:35708662-35708684
Sequence GGTTTGGTAAGTTCACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039254922_1039254925 15 Left 1039254922 8:35708624-35708646 CCTTTTTCTGAAAGGCTGTGAGC 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1039254925 8:35708662-35708684 GGTTTGGTAAGTTCACCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039254925 Original CRISPR GGTTTGGTAAGTTCACCTGA AGG Intronic
No off target data available for this crispr