ID: 1039258105

View in Genome Browser
Species Human (GRCh38)
Location 8:35741013-35741035
Sequence ATGAATGAGAGTGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1099
Summary {0: 1, 1: 1, 2: 5, 3: 102, 4: 990}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039258105 Original CRISPR ATGAATGAGAGTGAGGAGGA TGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900785932 1:4650548-4650570 ATGCATCAGAGAGAGGAAGACGG - Intergenic
900803495 1:4752178-4752200 AGGGAGGAGAGAGAGGAGGAGGG + Intronic
900871928 1:5310542-5310564 CAGAATGAGAGCGAGGAAGAGGG + Intergenic
901362921 1:8719237-8719259 ATGAAGGGGAGAGAGGAGGCAGG - Intronic
901396266 1:8984263-8984285 AAGAAAGAGAGGGAGGGGGAGGG + Intergenic
901670759 1:10855242-10855264 ATGACTGAGAAAGATGAGGAGGG - Intergenic
901677224 1:10892696-10892718 ATGAAAGAGACAGAGGGGGAGGG - Intergenic
901685277 1:10940355-10940377 AGGAGTGGGAGGGAGGAGGAGGG + Intergenic
901916172 1:12502331-12502353 TGGAATCTGAGTGAGGAGGAGGG + Intronic
902536273 1:17120680-17120702 AGGAATGTGAGTGGGGAAGAGGG + Intergenic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
902686203 1:18079295-18079317 ATGAAGGAGAGGGGGAAGGAAGG + Intergenic
902713335 1:18255541-18255563 AGAAATGAGAGTGAGGAGTGTGG - Intronic
902840519 1:19071160-19071182 ATGAGAGGGAGTGGGGAGGAGGG + Intergenic
902922101 1:19672204-19672226 ATGGATGGGAGTGGGGAGGAAGG - Intronic
903295901 1:22342925-22342947 ATGGGTGGGAGAGAGGAGGAGGG + Intergenic
903544202 1:24113401-24113423 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
904262526 1:29297910-29297932 TTGACTGATGGTGAGGAGGAAGG + Intronic
904482074 1:30800414-30800436 CTGGAGCAGAGTGAGGAGGAAGG + Intergenic
904487888 1:30839835-30839857 ATGAATGATGGATAGGAGGATGG + Intergenic
904734801 1:32623428-32623450 TTGATTGAGAGTGAGAATGAGGG - Intronic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904837170 1:33346690-33346712 CTGGATGAAAGTGAGGAGGTGGG + Intronic
904890650 1:33777016-33777038 ATCAGTGACAGTGATGAGGAGGG + Intronic
905541742 1:38765404-38765426 ATGAATGTGTCTTAGGAGGATGG - Intergenic
905942921 1:41878689-41878711 TAGAAAGAGAGGGAGGAGGAGGG - Intronic
906014776 1:42565833-42565855 ATAAAAGAAAGTGATGAGGAAGG + Intronic
907325045 1:53632274-53632296 ATGAGTGTGACTGAGGAGAAGGG + Intronic
907325113 1:53632780-53632802 ATGAGTGTGACTGAGGAGAAAGG + Intronic
907641899 1:56199054-56199076 ATGAATTAAAGGGAGGAGGTTGG - Intergenic
907676896 1:56526213-56526235 ATGAAGGAAAGGGAGCAGGACGG + Intronic
907708380 1:56852853-56852875 ATCAAAGACAGTGAGGATGAAGG + Intergenic
907713483 1:56906255-56906277 ATGATGGAAAGGGAGGAGGAGGG + Intronic
907818986 1:57948521-57948543 TTGGTTGAGAGTGAGGGGGAGGG - Intronic
908414449 1:63899178-63899200 ATGAAAGAGACTGATGAGGAAGG - Intronic
908422911 1:63977053-63977075 AAGAATGAGAGTGAAGTGGGGGG + Intronic
908693658 1:66811620-66811642 TTGAAGGAGAGTGAGGAGTGGGG + Intergenic
908857947 1:68450297-68450319 ATGAATGAGGGTGAGAATGAAGG - Intergenic
909128397 1:71705830-71705852 AAGAAAGAGAGAGAGAAGGAAGG + Intronic
909214555 1:72869767-72869789 AAGAGAGAGAGAGAGGAGGAAGG + Intergenic
909498257 1:76304151-76304173 ATGAAGGAGAGAAAGAAGGAAGG - Intronic
911254139 1:95614825-95614847 AAGAATGAGAGAAGGGAGGAAGG - Intergenic
911661868 1:100510502-100510524 ATGGAGCAGAGTTAGGAGGAGGG - Intronic
911672266 1:100620472-100620494 ATGAGAGAGAGGGAGCAGGAGGG - Intergenic
911768839 1:101713310-101713332 ATGAATTAGAAGCAGGAGGAAGG - Intergenic
912282277 1:108328409-108328431 AAGAATGAAAGTGAAGAAGAGGG - Intergenic
912412846 1:109490039-109490061 AGCGAAGAGAGTGAGGAGGAGGG + Exonic
913014990 1:114723882-114723904 ATGATTGAGATTGTGGAGGAGGG - Exonic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913197031 1:116465822-116465844 ATGATTGAGAGGGAGGGAGAAGG - Intergenic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
913944243 1:125142776-125142798 AAGAATGAAAGAAAGGAGGAAGG + Intergenic
914675883 1:149906939-149906961 ATGTATGAAAGTTAGTAGGAGGG + Intronic
914977786 1:152381468-152381490 AGGAAAGAGAGAGAGGAGGCAGG + Intergenic
915232573 1:154456565-154456587 ATGAAGGAGAGGGAGGAGTCCGG + Intronic
915615316 1:157033310-157033332 ATGAAGGAGAGTGTGGGGCAAGG - Intronic
915833375 1:159152329-159152351 GTGAAAGAGATTGAGAAGGAGGG - Intergenic
915939901 1:160112413-160112435 ATGAAAGAGAGAGAGGAGGAGGG - Intergenic
915984878 1:160454621-160454643 ATGAAGAAGAGTGAGGTAGACGG + Intergenic
916267287 1:162903486-162903508 ATTAAAGAGAGGGAGGAGCAGGG - Intergenic
916344573 1:163773378-163773400 ATGAATCAGAGTGAGGAATATGG - Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916473083 1:165142739-165142761 ATGAAGGAGAGAAAGGAGGAAGG - Intergenic
916547082 1:165816057-165816079 ATGAAGGAGAGAGAGAAGCAAGG - Intronic
917149266 1:171927780-171927802 ATCATTGAGATTCAGGAGGATGG - Intronic
917396202 1:174596375-174596397 ATGAAAGAAACTGAAGAGGAGGG - Intronic
917500174 1:175578571-175578593 ATGAATGAGAGAAGGGAGGAGGG + Intronic
917554764 1:176072477-176072499 ATGAATGGGAGTGCAGAGGGAGG - Intronic
917640826 1:176981691-176981713 ATGAAGGAGAGAGAGGAGTCTGG + Intronic
917773359 1:178305132-178305154 ATGAAAGAAATTGAAGAGGATGG + Intronic
917806546 1:178618823-178618845 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
917995982 1:180438917-180438939 ATGGAGGAGAGTGGGGAGGGAGG - Intronic
918023087 1:180714235-180714257 AAGGATGAGAAGGAGGAGGAAGG - Intronic
918057048 1:181031177-181031199 AGGAAGGAGAGAGAGAAGGAGGG - Intergenic
918079194 1:181192600-181192622 ATGAATGAGGGAGAGGGGAATGG - Intergenic
918302549 1:183217109-183217131 AGGAATGTGAGGGAGAAGGAGGG + Intronic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
919145504 1:193629429-193629451 ATGAGGGAGAGGGAGGAGAAGGG + Intergenic
919543521 1:198881305-198881327 ATAAATAAGTGTGAGGAGGAAGG - Intergenic
920035409 1:203061915-203061937 AAGAATGAGACTGAGGAGAAGGG - Intronic
920346882 1:205311837-205311859 AGGCATGAGAGTGAGGAGAAAGG + Intronic
920459863 1:206131159-206131181 AGGAGTTAGAGAGAGGAGGAGGG + Intergenic
920570813 1:207015978-207016000 ATTACTGAGGGTGAGGAAGAGGG - Intronic
920693862 1:208166885-208166907 ATGGTTTGGAGTGAGGAGGAAGG - Intronic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921983978 1:221289185-221289207 ATGAAGGAGAGTGAGAATGATGG + Intergenic
921993475 1:221392461-221392483 ATTGATGAGGGTGAGGAGCAGGG + Intergenic
922454562 1:225764247-225764269 ATGGAAGTGAGTGAGGGGGATGG - Intergenic
922990658 1:229908240-229908262 AAAAATGAGAATGAGGGGGACGG - Intergenic
923367568 1:233277731-233277753 ATGGAGGGGAGTGTGGAGGAGGG + Intronic
923548691 1:234943872-234943894 ATGAGGGAAAGTGAGGAGAAAGG + Intergenic
923563391 1:235058792-235058814 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
923936881 1:238771237-238771259 ATAAAAGAGAATGAGGAGGCCGG - Intergenic
924646603 1:245883627-245883649 ATGAAGGACAGTGAAGAGCAGGG - Intronic
1063008160 10:1994690-1994712 CTGAATGGGAGTGAGGGGCAGGG + Intergenic
1063484297 10:6404795-6404817 ATGAAAGAGAGAGAGAAAGAAGG - Intergenic
1063714127 10:8510457-8510479 TTGAATGAGAGTGAAGAGGATGG - Intergenic
1063885035 10:10568737-10568759 AAAAATGTGAGTGAGGAGGAGGG + Intergenic
1064274572 10:13894037-13894059 AGGAATGAGAGAAAGGAGGGAGG - Intronic
1064354534 10:14604855-14604877 ATGAAAGAGAATGAGAATGAGGG - Intronic
1064462799 10:15551253-15551275 ATGGATGAGAGAGAAGAGGAGGG + Intronic
1064841567 10:19598096-19598118 ATGGATTGGAGTGAGGAAGAGGG + Intronic
1065063153 10:21929753-21929775 ATGAACCAGACTGAGGAGGCTGG - Intronic
1065120070 10:22520710-22520732 ATGCATGAGAGAGAGAGGGAGGG - Intergenic
1065729557 10:28698643-28698665 ATGTATGAGAGAGAGCAAGAGGG + Intergenic
1065795041 10:29298843-29298865 ATGAACCAGAGGGAGGAGGATGG + Intronic
1066193843 10:33079687-33079709 AGGATTGAGAGGGAGGTGGAAGG - Intergenic
1067223298 10:44359355-44359377 GTGAATGAAAATGACGAGGAAGG + Intergenic
1067527965 10:47049702-47049724 ATGAAGGCGAGGGAGGAGCATGG + Intergenic
1068076340 10:52260095-52260117 GGGAATGAGGGTGGGGAGGATGG - Intronic
1068507123 10:57915173-57915195 ATTAAGTAGACTGAGGAGGAGGG + Intergenic
1068796918 10:61093566-61093588 ATGAGAGACAGTGAGGAGGGTGG + Intergenic
1069539329 10:69281805-69281827 AGGAAGGGGAGGGAGGAGGAAGG + Intronic
1069548203 10:69343788-69343810 AGGAAGGAGAGTGAGGTCGAGGG - Intronic
1069640870 10:69954754-69954776 ATGAAAGAAAGGGACGAGGAAGG - Intronic
1070106734 10:73439931-73439953 ATGAATGAGAGAGATGAGAAGGG + Intronic
1070224570 10:74488157-74488179 ATGAAAGACAGTAAGGAGAATGG + Intronic
1070858393 10:79628422-79628444 ATGAGTGTGAGTTTGGAGGAAGG + Intergenic
1071122707 10:82298188-82298210 ATGACAGAGAGAGAGCAGGAAGG + Intronic
1071156050 10:82690966-82690988 AAGAAGGAGAAAGAGGAGGAAGG - Intronic
1071271206 10:84009316-84009338 ATTAGAGAGAGGGAGGAGGAGGG - Intergenic
1071514655 10:86289266-86289288 ATGAAACTGAGTGAGGAAGAGGG + Intronic
1071554897 10:86594373-86594395 AGGAAGGAGAGGGAGGGGGAGGG + Intergenic
1072257597 10:93635183-93635205 AAGAATGAGAGGGAACAGGAAGG - Intronic
1072548368 10:96457729-96457751 ATGGCTGAGGGTGAAGAGGAAGG + Intronic
1072573055 10:96675276-96675298 ATGAATAAGAGGGGGAAGGAAGG + Intronic
1072743688 10:97925608-97925630 ATGAGTGAGAGTGAGTGTGAGGG + Intronic
1073887702 10:108059548-108059570 ATAAATGAGAAGGAAGAGGAAGG - Intergenic
1074165261 10:110869447-110869469 ATGAAAGACAGGGAGGAAGAAGG + Intergenic
1074761975 10:116673826-116673848 ATGAAGGTGAGTGGGAAGGAGGG + Exonic
1074786552 10:116847274-116847296 ATGAGTGAGAGAGAATAGGAAGG - Intergenic
1074994978 10:118748945-118748967 AGGAAGAAGAGTCAGGAGGAGGG + Intronic
1075064213 10:119278639-119278661 ATGAATGAGTGATAGGTGGAAGG - Intronic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1076161348 10:128246547-128246569 AAGGAAGAGAGGGAGGAGGATGG - Intergenic
1076253227 10:128999396-128999418 AAGAATGAAAGTGAGGAAGTTGG + Intergenic
1076287320 10:129312883-129312905 ATGAGAGAGAGTGGGGAGGAAGG + Intergenic
1076402774 10:130194542-130194564 AGGAGGGAGAGGGAGGAGGACGG + Intergenic
1076554776 10:131313999-131314021 AGAAATGAGAGCCAGGAGGAGGG - Intergenic
1077607302 11:3620865-3620887 GTGGATGAGAGTGAGGAGCAAGG - Intergenic
1077719776 11:4616272-4616294 ATGAAAGAGAGTAAAGTGGATGG - Intergenic
1077769929 11:5206193-5206215 CTGACTGAGAGTGTAGAGGAGGG - Intergenic
1078257386 11:9670245-9670267 ATGATTGGGTGGGAGGAGGACGG + Intronic
1078446021 11:11405429-11405451 AGGAATGAGATGGAGGTGGAAGG + Intronic
1078960320 11:16259764-16259786 ATGATTGGGAGGGAGGAAGAGGG + Intronic
1079077347 11:17392292-17392314 AAGAATGAAAGTGAGAAGAAAGG + Intergenic
1079330793 11:19531282-19531304 ATGAACCAGAGTAAGGAGGCAGG + Intronic
1080292395 11:30685386-30685408 ATGAATGGGGGTGGGGAGAAGGG + Intergenic
1080797218 11:35575942-35575964 GTGAGCGAGAGTGAGGAGGCAGG - Intergenic
1080961268 11:37163261-37163283 AGGTGTGAGAGTGAGGAGGAAGG + Intergenic
1081051204 11:38343537-38343559 ATGGATGAGAGTGTAGAGAAAGG - Intergenic
1081434102 11:43008271-43008293 AAGAAAGAGAGAGAGGGGGAGGG + Intergenic
1081604262 11:44517564-44517586 ATGGAGGAGGGAGAGGAGGAAGG + Intergenic
1082167025 11:48962060-48962082 ATGAAACAGAGAGAGAAGGAGGG - Intergenic
1082236557 11:49824666-49824688 ATGAAAGAGAGAGAGAGGGAGGG + Intergenic
1082718410 11:56643264-56643286 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
1082796811 11:57383770-57383792 ATGAATGAGTGTGAGGCTCATGG - Intergenic
1083017650 11:59472501-59472523 ATGACTGAGACAGAAGAGGATGG + Intergenic
1083360554 11:62104471-62104493 AAGAATGAGAGCGAGGGGGTGGG - Intergenic
1083724448 11:64620969-64620991 ATGAGTGAGTGTAAGGAGGAGGG + Intronic
1083811560 11:65109455-65109477 ATCAGTGAGAGTGAGGATGTAGG - Exonic
1083829531 11:65222555-65222577 ATGAACGGGAGGAAGGAGGAAGG + Intergenic
1084596212 11:70118478-70118500 ATGAATGACAGTTGGGTGGATGG + Intronic
1085435541 11:76496929-76496951 ATGAATAAGAGTGAGGAAAGTGG + Intronic
1085633266 11:78137502-78137524 ATGATTGAGCTTGATGAGGAAGG - Intronic
1086150905 11:83609643-83609665 AAGGATGAGAGTGGGGAGAAGGG - Intronic
1086446653 11:86878226-86878248 ATGAGGGAGAGGGAGGGGGAGGG - Intronic
1086877945 11:92120507-92120529 ATCAATGAGATTGAGCAAGATGG - Intergenic
1087032686 11:93721737-93721759 ATGAATGAGATTGAGGGTGGGGG + Intronic
1087046156 11:93845573-93845595 AGGAATGAGAGTGGGAGGGATGG - Intronic
1087229340 11:95642156-95642178 AAGGAAGAGAGAGAGGAGGAAGG + Intergenic
1087678894 11:101195714-101195736 AGGAATGAAAGAAAGGAGGAAGG - Intergenic
1087717240 11:101622623-101622645 ATGAAATGGAGTGAGAAGGAAGG + Intronic
1088000576 11:104875588-104875610 ATGAATCAGAGGCAGGAGTAGGG + Intergenic
1088070140 11:105773108-105773130 AAGAATGAGAAGGAGGAGTAGGG - Intronic
1088423779 11:109677965-109677987 ATGAATGAGACTGAAGAATAAGG - Intergenic
1088447168 11:109944092-109944114 ATGAGGGAGAGGGAGGAAGAAGG + Intergenic
1088526216 11:110758442-110758464 ATGAATTAGAGGGTGCAGGAAGG + Intergenic
1088589569 11:111391805-111391827 ATAAATTAGAGTTAGGAGAAAGG + Intronic
1088842354 11:113637780-113637802 TTGAGTGACAGAGAGGAGGAGGG + Intergenic
1088862656 11:113816550-113816572 ATGTGAGAGAGTGAGGAGGAGGG - Intronic
1088920892 11:114259191-114259213 AAGAAAGAGAGGGAGAAGGAGGG + Intronic
1089079642 11:115765063-115765085 ATGAAAGAGAGTGGTCAGGAAGG - Intergenic
1089632077 11:119790111-119790133 AGGAATGAGTGTGAGGGGGCTGG - Intergenic
1089821222 11:121227958-121227980 AAGACTGAGAGTGGAGAGGAGGG + Intergenic
1090048467 11:123357333-123357355 ATGAAAGATGGAGAGGAGGATGG + Intergenic
1090500405 11:127255374-127255396 AGGAGTGAGAGGGAGGAGGGAGG + Intergenic
1090674303 11:128974864-128974886 GACAATGAGAGTGAGGAGGAAGG - Exonic
1091056873 11:132427796-132427818 ATGATTCAGAGCGAGGAGGGCGG + Intronic
1091058552 11:132441059-132441081 AGGAAGGAGAGGGAGGAGGAAGG + Intronic
1091097806 11:132840440-132840462 ATGAATGAGAATGAGCAAAACGG - Intronic
1091602779 12:1928112-1928134 AGCAATGAGAGTGAGGAGCGGGG + Intergenic
1091618896 12:2070978-2071000 AGGAAGGAGAGAGAGAAGGAAGG - Intronic
1091633193 12:2177620-2177642 AAGAAAGAGAGAGAGAAGGAAGG - Intronic
1091710523 12:2737157-2737179 TTGAATGAGAGGGAGGGGGCAGG - Intergenic
1091931508 12:4399368-4399390 AAGAGAGAGAGAGAGGAGGAAGG + Intergenic
1092016006 12:5159008-5159030 ATGAAGGGGAGTGCGAAGGAGGG + Intergenic
1092101480 12:5887663-5887685 AGGAAGGAGAGAGAGAAGGATGG + Intronic
1092808438 12:12249491-12249513 TTGAATGAGGGGGAAGAGGAAGG - Intronic
1092989067 12:13877549-13877571 AGAAAGGAGAGAGAGGAGGAAGG - Intronic
1092990714 12:13896234-13896256 ATGAGTAATAGTGAGGAAGATGG + Intronic
1093391497 12:18629497-18629519 CTAAAAGAAAGTGAGGAGGATGG + Intronic
1093772723 12:23036352-23036374 ATGAATGACAGTAATCAGGATGG + Intergenic
1094061198 12:26316763-26316785 AAAAATAACAGTGAGGAGGAGGG - Intergenic
1094490932 12:30960158-30960180 ATGTATGAGACTGAGCAGGGAGG + Intronic
1094582709 12:31749163-31749185 AGGCAATAGAGTGAGGAGGACGG + Intergenic
1094584753 12:31767803-31767825 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095409436 12:41906152-41906174 ATGAGTAGGAGTGAGGTGGAGGG - Intergenic
1096179902 12:49544890-49544912 ATGAAGGAGAGTGAAGATGCTGG - Intronic
1096445147 12:51683097-51683119 ATGTATGAGAGGCAGCAGGAGGG - Intronic
1096576248 12:52554609-52554631 ATGGATGGGAGGGATGAGGAGGG - Intergenic
1096793163 12:54057827-54057849 ATGTATGTGAGGGAAGAGGAAGG - Intergenic
1096862773 12:54541947-54541969 AAGAATGAGAGTGGGGGTGAGGG - Intronic
1097133286 12:56830088-56830110 AGGAAAGAGAGAGAGAAGGAAGG - Intergenic
1097495860 12:60332847-60332869 ATTAATGAGAGTGATCAGTAAGG + Intergenic
1097573588 12:61362209-61362231 ATCAATGAAGGTGGGGAGGAAGG + Intergenic
1097703798 12:62847020-62847042 ATGAATGGGACGGAGGAGGGTGG - Intronic
1097932119 12:65199893-65199915 ATGAATGAGAGTTCTGAGGCAGG + Intronic
1098337626 12:69420247-69420269 TTGGATGAGAGGGAGGAGGCAGG + Intergenic
1099253001 12:80281232-80281254 TTGAATGAGAGTGATGAGAGTGG + Intronic
1100017982 12:90035186-90035208 ATGAGGGAGAGTGGGGAGGGTGG + Intergenic
1100274266 12:93057755-93057777 ATGAGTGAGCTTGAGGAGCATGG - Intergenic
1100376725 12:94023337-94023359 ATAAAAGAGAGTGAGCAAGATGG - Intergenic
1100410232 12:94310383-94310405 ATGAATGGGGGTGAGTAGGAGGG - Intronic
1100429315 12:94516341-94516363 ATAGAAGAGATTGAGGAGGAGGG - Intergenic
1100525039 12:95411070-95411092 AGGAAGGAGAGTCAGGAGGAGGG - Intergenic
1100563046 12:95768394-95768416 ATGAATGAGAGGCAGGATTAGGG + Intronic
1101071419 12:101080012-101080034 ATGAACGAGAGGGAGGAGAGTGG - Intronic
1101276845 12:103211596-103211618 AACCATGAGAGTGAGCAGGAAGG + Intergenic
1101302848 12:103499086-103499108 ATGATGGGGAGCGAGGAGGATGG + Intergenic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1101833471 12:108277783-108277805 AAGAAAGAAAGAGAGGAGGAAGG - Intergenic
1102230229 12:111257200-111257222 AGGAAGGAGAGGGAGGAGGAGGG - Intronic
1102230389 12:111257695-111257717 AAGATGGAGAATGAGGAGGAAGG - Intronic
1102232355 12:111272307-111272329 ATGGAGGAGGGAGAGGAGGAGGG - Intronic
1102591394 12:113959232-113959254 GGGCAGGAGAGTGAGGAGGAGGG - Exonic
1102737836 12:115179058-115179080 AAGAAGGACAGGGAGGAGGAGGG + Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102992082 12:117322613-117322635 AGGAATGAGAGAGGGTAGGAAGG - Intronic
1103074111 12:117968611-117968633 AAGGAGGAGAGAGAGGAGGAGGG + Intronic
1103139169 12:118533869-118533891 ATGAAAGAAAGGGAGGTGGATGG - Intergenic
1103257164 12:119551621-119551643 ATGAATGAGAGTCAGGAGGAAGG - Intergenic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1103683269 12:122711538-122711560 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1103763991 12:123269294-123269316 AGGGCTGAGAGGGAGGAGGAAGG + Intronic
1103936739 12:124481143-124481165 AAGAAAGAGAGGGAGGAAGAAGG + Intronic
1103946784 12:124531583-124531605 GGGAAGGAGAGAGAGGAGGATGG + Intronic
1104490352 12:129188717-129188739 ATAAATGAGAGAGAGAGGGAAGG + Intronic
1104550046 12:129748350-129748372 GAGAATGAGACTGAGGAGGGAGG + Intronic
1104569493 12:129912552-129912574 AAGAAAGAGAGAGAGGAAGACGG + Intergenic
1104686048 12:130785246-130785268 ATGCATGAGACAGAGGAGGCTGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105468662 13:20671796-20671818 ATGCATGAGAGTGCTGAGTATGG - Intronic
1105600438 13:21881826-21881848 ATGACTGAGGGAGAGGAGGCAGG - Intergenic
1105770744 13:23609483-23609505 ATTAATACGAGTGAGGAGGATGG - Intronic
1106046846 13:26150368-26150390 AGGATTGTGAGTGTGGAGGAAGG + Intronic
1106798433 13:33231505-33231527 ATGAATGAGGGACTGGAGGAGGG + Intronic
1107299319 13:38948517-38948539 ATGAATGGGCTAGAGGAGGAGGG - Intergenic
1107446574 13:40474807-40474829 ATGAAAGAGTTTAAGGAGGATGG - Intergenic
1107765594 13:43730825-43730847 CGGAATGAGGGTGAGGATGAAGG - Intronic
1107855363 13:44610325-44610347 ATGAGAGAGAGGGAAGAGGAAGG + Intergenic
1108018654 13:46102181-46102203 AGGAATTAGAGAGTGGAGGAGGG - Intronic
1108325982 13:49331858-49331880 ATGAAGGAGAGTAAAGAGCAGGG + Intronic
1108598699 13:51972342-51972364 AAGAATTAGAGGGAGGAGGAGGG - Intronic
1108693481 13:52881478-52881500 AGGAGTGTGAGTGAGGAGGGTGG + Intergenic
1109149087 13:58822554-58822576 ATAAATGAGTGAGAGAAGGAGGG - Intergenic
1109303548 13:60614497-60614519 AGGTATGAGAGAAAGGAGGAAGG + Intergenic
1109394199 13:61733816-61733838 AGGAATGAGGGTGAGGAAAATGG - Intergenic
1110116568 13:71824555-71824577 ATGAATGAGTGAGAGAGGGAAGG + Intronic
1110202151 13:72864228-72864250 TTGCTTGAGAGTGAGGAGGATGG + Intronic
1110257555 13:73448593-73448615 GTGAAAGAGAGAGGGGAGGAAGG + Intergenic
1110306558 13:73994471-73994493 ATGAATGAAAGTGTGGTGGTGGG - Intronic
1110400445 13:75084108-75084130 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1110912419 13:80981157-80981179 AAGAAAGAGAGAGAGGAGGAAGG + Intergenic
1111640535 13:90963999-90964021 ATGACTAAGAGTGGTGAGGAAGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112250443 13:97774465-97774487 AAGAAGGAGAGGGAGGGGGAGGG - Intergenic
1112394862 13:99020120-99020142 AAGAATGAGGGTGGGGAGAATGG + Intronic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1112739277 13:102455257-102455279 ATGAATTAGAGTGGGGAGCCAGG + Intergenic
1113028841 13:105971566-105971588 ATAAATCAGAGTGAGAAGCAGGG - Intergenic
1113292283 13:108920398-108920420 AAGAAAGAGAGAGAGAAGGAAGG - Intronic
1113486411 13:110655812-110655834 ATGAATGAGACAGAGGAGAAAGG + Intronic
1113595943 13:111532897-111532919 ACGAAGCAGAGTGAGGAGGAAGG - Intergenic
1113659523 13:112096126-112096148 AGGAAGGGGAGGGAGGAGGAAGG - Intergenic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114188628 14:20423415-20423437 AAGAAAGAGAGTGAGGCAGAAGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114210674 14:20611545-20611567 GTGAGTGAGAAGGAGGAGGAGGG + Intergenic
1115433565 14:33348307-33348329 AAAAATGAGGGTGAGGAGGCAGG + Intronic
1115573191 14:34686388-34686410 AAGGGTGAGAGTGAGGAAGAAGG + Intergenic
1115902983 14:38174834-38174856 GTGAAGGAGAGTGAGCAGGTAGG - Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1117419594 14:55531046-55531068 AAGATTGAGACAGAGGAGGAAGG + Intergenic
1117689510 14:58291811-58291833 ATCAATGAGAGTGTTTAGGAAGG - Intronic
1117870281 14:60193441-60193463 ATGAATGTCAGTGAGGATGTAGG - Intergenic
1117930300 14:60835003-60835025 ATGAATGAGAGAGAGAGGGAGGG - Intronic
1118015044 14:61651897-61651919 GTGATTGAGAGGGAGGAGGCAGG + Intronic
1118202021 14:63683581-63683603 ATGAATGACAGGGAGGGTGAGGG + Intergenic
1118340594 14:64893425-64893447 ATCCATGAGAGAGAGGAAGAAGG + Intergenic
1118746753 14:68779705-68779727 TAGATAGAGAGTGAGGAGGAGGG + Intergenic
1119249568 14:73139844-73139866 TTGGATGAGAGTGAGGAAAAAGG + Intronic
1119888190 14:78162069-78162091 ATGAAAGGGAGTGAGGAAGCGGG + Intergenic
1120161416 14:81149306-81149328 GTGCATGGGAGTGGGGAGGAGGG - Intergenic
1120352517 14:83381061-83381083 AGGAATGAGAGTGGGGTGGAAGG + Intergenic
1120648915 14:87107417-87107439 ATGAATGAGGGAGAGGTGAATGG - Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121233812 14:92377864-92377886 CTGAATGAAGGTGAGGAAGAAGG + Intronic
1121750393 14:96349640-96349662 ATGAATGACACTTAGGAGGCTGG + Intronic
1121923297 14:97903650-97903672 GTGAAGGAGAGTAATGAGGATGG - Intergenic
1122447883 14:101782170-101782192 AGGAAAGAGAGGGAGGGGGAGGG - Intronic
1123123374 14:105928393-105928415 ATGCAGGAGAGTGAGAAGCATGG - Intronic
1123996555 15:25721933-25721955 ATGAATGACCGTGAGGACCAGGG + Intronic
1127278285 15:57466989-57467011 ATGGATGAGGGAGAAGAGGAGGG + Intronic
1127281317 15:57496053-57496075 ATGAGTGAAAGACAGGAGGAGGG + Intronic
1127308219 15:57728658-57728680 GTGAATCAGAGTCAGGAGGTGGG - Intronic
1127529885 15:59833474-59833496 AAAATTGAGAGTGAGAAGGATGG - Intergenic
1127564165 15:60170187-60170209 ATGCAGGAGACTGAGGTGGAAGG - Intergenic
1127604826 15:60576020-60576042 AAGGATGGGAGTGAAGAGGAAGG - Intronic
1127908107 15:63392191-63392213 AGGAGTGAGTGGGAGGAGGATGG - Intergenic
1127916652 15:63460531-63460553 ATTAATGAGAGATAGGAGGTGGG + Intergenic
1127956789 15:63860695-63860717 AGGCCAGAGAGTGAGGAGGAAGG - Intergenic
1128238375 15:66082805-66082827 ATGAATGAATGAGAGGTGGAGGG - Intronic
1128264379 15:66254055-66254077 AAGAACGAAAGTGGGGAGGAGGG - Intergenic
1128286160 15:66438808-66438830 CTGAATGAGAGTGGCCAGGATGG + Intronic
1128365242 15:66995276-66995298 ATGAATGAGAAATAGGGGGATGG - Intergenic
1128673518 15:69592664-69592686 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1128679781 15:69640816-69640838 TTGAATAAGAGTGGTGAGGATGG + Intergenic
1128761952 15:70223145-70223167 ATGAAAGAAAGAAAGGAGGAAGG - Intergenic
1129221791 15:74135452-74135474 AAGAAAGAAAGGGAGGAGGAGGG - Exonic
1129336965 15:74858130-74858152 AAGAAAGGGAGGGAGGAGGAGGG + Intronic
1129446485 15:75622494-75622516 AAGAATGGGAGTGGGGAGAAAGG + Intronic
1130383820 15:83394229-83394251 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
1130829616 15:87585820-87585842 AAAAATGGAAGTGAGGAGGAGGG + Intergenic
1131161820 15:90110351-90110373 ATGAAAGAGAGAGAGATGGAGGG + Intergenic
1131457925 15:92597712-92597734 CAGAATGGGAGTGGGGAGGAAGG - Intergenic
1131509380 15:93041156-93041178 ATGAATGAGAGTCACGATGAAGG - Intronic
1131558015 15:93415879-93415901 TGGAATTGGAGTGAGGAGGAAGG + Intergenic
1131632130 15:94188979-94189001 ATGAAAGAAATTGAAGAGGAGGG + Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132023509 15:98384954-98384976 AAGAATGAGAGAAAGAAGGAAGG + Intergenic
1132078641 15:98845515-98845537 AGGAAGGAGGGGGAGGAGGAAGG - Intronic
1132095667 15:98982666-98982688 AATAACCAGAGTGAGGAGGAAGG - Intronic
1132201349 15:99956609-99956631 ATGAAAGAGACTGTGGAGAATGG + Intergenic
1132271622 15:100531364-100531386 AGGAATGAGAGTGAGGAACTCGG + Intronic
1132629327 16:909229-909251 AGGGATGTGAGTGAGGGGGAGGG + Intronic
1132719201 16:1307658-1307680 ATGAATGAGGGAGAGAGGGAGGG + Intergenic
1132989832 16:2786944-2786966 AGGGAGGGGAGTGAGGAGGAGGG - Intronic
1132989911 16:2787202-2787224 AGGGAGGGGAGTGAGGAGGAGGG - Intronic
1132989975 16:2787390-2787412 AGGGAGGGGAGTGAGGAGGAAGG - Intronic
1133392735 16:5422702-5422724 AGGAAAGAGAAAGAGGAGGAGGG + Intergenic
1133730765 16:8576693-8576715 ATGAATGAGAGCAGGAAGGAAGG + Intronic
1133853074 16:9524292-9524314 ATGAAGGAAGGTGGGGAGGAAGG - Intergenic
1134388668 16:13797801-13797823 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1135078955 16:19417651-19417673 ATTAATGAGAGGGAGGAGTTAGG + Intronic
1135469512 16:22717008-22717030 ATTAAGGAGGTTGAGGAGGAAGG + Intergenic
1135559883 16:23468142-23468164 ATGAAAGAGAGAGAGAGGGAGGG - Intronic
1136316053 16:29455209-29455231 ATGCAGGAGAGAGAGGAGGTGGG + Intronic
1136430630 16:30194551-30194573 ATGCAGGAGAGAGAGGAGGTGGG + Exonic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136676268 16:31909431-31909453 ATGAAAGACATTGAAGAGGATGG - Intronic
1137248583 16:46726761-46726783 AAGAAAGAGAGAGAGGGGGAGGG + Intronic
1137718386 16:50612772-50612794 AGGAATGAGAGTGGGGTGGTCGG + Intronic
1137758766 16:50923825-50923847 ATGAATGAAAGAGAGAAGGAAGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138252266 16:55510038-55510060 ATGGATAAGAGTGAGGCAGAAGG + Intronic
1138339880 16:56281619-56281641 ATGAGCTGGAGTGAGGAGGAAGG - Intronic
1139147419 16:64341496-64341518 AGGAAGGAGAGGGAGGAGGGAGG - Intergenic
1139147447 16:64341586-64341608 AGGAAGGAGAGGGAGGAGGGAGG - Intergenic
1139388800 16:66592258-66592280 AAGAAAGAGAGGGAGAAGGAAGG + Intergenic
1139581579 16:67876976-67876998 AGTAAAGACAGTGAGGAGGAAGG + Intronic
1139712931 16:68790255-68790277 ATCAGGGAGAGAGAGGAGGAGGG + Intronic
1140104433 16:71946805-71946827 ATGAGAGAGGGGGAGGAGGAGGG + Intronic
1140121696 16:72089292-72089314 GTGAATGAGACTCTGGAGGATGG - Intronic
1140185041 16:72761670-72761692 AAGAAAGAGAGTGAGCAAGATGG + Intergenic
1140740443 16:77936771-77936793 AGGAAGGAGAGGGAGGAAGAGGG + Intronic
1140903607 16:79392307-79392329 AGGAGAGAGAGGGAGGAGGAGGG + Intergenic
1141220930 16:82068755-82068777 ATGAAGGAAAGAGAAGAGGAAGG - Intronic
1141372464 16:83500527-83500549 AGGAGGGAGAGGGAGGAGGAGGG - Intronic
1141372470 16:83500543-83500565 AGGAGGGAGAGGGAGGAGGAGGG - Intronic
1141556686 16:84841176-84841198 CTGACTGAGAGGGAGGAGTAAGG + Intronic
1141609714 16:85174525-85174547 ATGAATGGGAAGGAGGGGGAGGG - Intronic
1141731563 16:85826291-85826313 AGGAATGACAGAGAAGAGGAAGG - Intergenic
1141856213 16:86683059-86683081 AGCAAAGAGAGGGAGGAGGAGGG + Intergenic
1142139162 16:88465035-88465057 AGGGAGGAGGGTGAGGAGGATGG + Intronic
1142203751 16:88773151-88773173 ATCAATGAGACCCAGGAGGAAGG - Intronic
1143003435 17:3810636-3810658 GTGACTGAGAGTGGGCAGGAGGG + Intergenic
1143701334 17:8662581-8662603 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1143905468 17:10205611-10205633 ATGATTCTGAGAGAGGAGGAAGG + Intergenic
1143972603 17:10806292-10806314 ATGAAAGTGAGTAAGGAGGGTGG + Intergenic
1144102412 17:11953384-11953406 GTGAATGAGAGTGATAAGGAGGG - Intronic
1144102833 17:11959215-11959237 ATGAACAAAAGTGATGAGGATGG - Intronic
1144334341 17:14255524-14255546 TTGTAGGAGAGGGAGGAGGAGGG - Intergenic
1144375552 17:14636306-14636328 AAGATGGAGAGTGAGCAGGAAGG + Intergenic
1144657313 17:17045032-17045054 AAGGATGAGAGTGAGAGGGAGGG - Intronic
1145279791 17:21458615-21458637 ATGAGTGAGGGAGAGGAGGGAGG + Intergenic
1145398090 17:22511864-22511886 GTGAGTGAGGGAGAGGAGGAAGG - Intergenic
1145831083 17:27916892-27916914 AGAAAGAAGAGTGAGGAGGAAGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1147054310 17:37822662-37822684 AAGAATGAGAGAGGGAAGGAAGG - Intergenic
1147529595 17:41263193-41263215 AGGAAAGAGAGTGAAAAGGAAGG + Intergenic
1147539860 17:41348271-41348293 AGGAATGAGAGTGAGGAAGTTGG - Intronic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1147785764 17:42977635-42977657 AAGAAAGAGAGAGAGGGGGAGGG + Intronic
1147977489 17:44256113-44256135 ATGAATGAGTGGGTGGATGATGG - Intronic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1148534404 17:48427090-48427112 AAGACTGAGAGTTTGGAGGAGGG - Intronic
1149017082 17:51920361-51920383 ATGAAAGGGAGGGAGGAGGTTGG + Intronic
1149464851 17:56869840-56869862 ATGAAAGGCAGTGGGGAGGATGG - Intergenic
1149544054 17:57489919-57489941 AGGAATTAGGGTGAGCAGGAGGG + Intronic
1149647594 17:58251464-58251486 ATGAATCCGAGTGAGCAGCAGGG + Intronic
1149867908 17:60160942-60160964 AGGCAGGAGAGTGAGGTGGAGGG + Intronic
1150006909 17:61475616-61475638 GTGGATGACAGTGAGGAGGAGGG + Intronic
1150493316 17:65589107-65589129 GGGGATGAGAGTGAGGGGGACGG + Intronic
1150726723 17:67657047-67657069 AAGGAGGACAGTGAGGAGGAGGG + Intronic
1150893866 17:69186465-69186487 ATGAATGAGAGATAGACGGAGGG - Intronic
1151194871 17:72424298-72424320 ATGAAAGGGAGTGGGGAAGATGG - Intergenic
1151345264 17:73497573-73497595 ATGCAGGAGAGGGAGGAAGATGG - Intronic
1151405866 17:73885711-73885733 ATGAATGTGCCAGAGGAGGAAGG - Intergenic
1151525307 17:74661712-74661734 AAGAAAGAGAGAGAGGGGGAGGG + Intergenic
1151677984 17:75609650-75609672 AAGAAAGAGAGAGAGGAGGAGGG - Intergenic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1152038141 17:77885716-77885738 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1153014827 18:574070-574092 ATGGAAAAGTGTGAGGAGGAAGG - Intergenic
1153138650 18:1946654-1946676 ATGAGTGGATGTGAGGAGGAAGG - Intergenic
1153178469 18:2405894-2405916 ATGAAGGAGAGAGGGAAGGAAGG + Intergenic
1153496440 18:5704514-5704536 ATGAATAAGAGTATGCAGGAAGG - Intergenic
1155614244 18:27702756-27702778 AAGAATGATAGTGAGAAGGTAGG - Intergenic
1155740814 18:29285592-29285614 AGGAAAGAGAGTGAAGAGGTAGG + Intergenic
1156436602 18:37137288-37137310 AGGAATGAGAGTGGAGAGGAAGG - Intronic
1156442836 18:37208825-37208847 AGCAATGGGAGTGAGGAGGAAGG + Intronic
1156895792 18:42244144-42244166 AGGAAAGAGATTGTGGAGGATGG - Intergenic
1157319988 18:46626810-46626832 ATGAAGGAGACTGAGGAAGGGGG - Intronic
1157364537 18:47051908-47051930 AAGAAAGAGAGAGAAGAGGAGGG + Intronic
1157688505 18:49662168-49662190 AAGCATGACAGTAAGGAGGAAGG + Intergenic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1157867396 18:51197872-51197894 AGGAATGAGAGGGAGGTGGGCGG - Intronic
1158004878 18:52661040-52661062 AAGAAGGAGAGTGATAAGGATGG + Intronic
1158282131 18:55839807-55839829 AGGAATGGGAGTTAGGAGGTTGG - Intergenic
1158610442 18:58935319-58935341 AGGAGGGAGAGGGAGGAGGAAGG - Intronic
1158838714 18:61360074-61360096 GTGAATAAGAGTGGGGAGCATGG + Intronic
1159049595 18:63407479-63407501 AGGAATGACAGTGATGGGGAAGG - Exonic
1159092643 18:63867052-63867074 GTGAAGGGGAGGGAGGAGGAAGG + Intergenic
1159374580 18:67576620-67576642 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1160301373 18:77683244-77683266 ATGAAAGTGAGTTAGGAGAAAGG + Intergenic
1160316757 18:77855370-77855392 ATGAATGAGACTAGGGAGCAAGG - Intergenic
1160965748 19:1746234-1746256 AAGAGGGAGGGTGAGGAGGAGGG + Intergenic
1161122909 19:2539971-2539993 AGGAAAGAGAGAGAGAAGGAGGG - Intronic
1161258420 19:3322408-3322430 ATGGATGGGAGGGAGGTGGATGG + Intergenic
1161434816 19:4256852-4256874 AAGAGTGAGAGCAAGGAGGAAGG + Intronic
1161657615 19:5525610-5525632 ATGAATGAGTGTGTGATGGATGG - Intergenic
1161795124 19:6381875-6381897 AGGAGGGAAAGTGAGGAGGAAGG + Intronic
1162433439 19:10642971-10642993 TTGAAGGGGAGTGCGGAGGAGGG + Intronic
1163070072 19:14832398-14832420 AAGAAAGAGAGAGAGAAGGAAGG - Intronic
1163191179 19:15678021-15678043 ATGAGTGAGTGTGGAGAGGAAGG - Intronic
1163270784 19:16252306-16252328 ATGAATGAGGGTCAGGAGTGGGG - Intergenic
1163344247 19:16729892-16729914 AAGAAAGAGAGAGAGAAGGAAGG + Intronic
1163777918 19:19228618-19228640 ATGAATGCAGGTGCGGAGGAGGG + Exonic
1164237202 19:23347597-23347619 TTGTTTGAGAGTGAGGAAGAAGG - Intronic
1164306023 19:24004198-24004220 ATGAATGGGAGGTGGGAGGAAGG + Intergenic
1164425965 19:28142258-28142280 AGGAAAGAGAGAGAGAAGGAAGG + Intergenic
1164425987 19:28142424-28142446 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164466061 19:28488675-28488697 AAGGAAGAGAGGGAGGAGGAAGG - Intergenic
1164591931 19:29512145-29512167 AAGAGGGAGGGTGAGGAGGAAGG + Intergenic
1164891260 19:31825690-31825712 ATGAATGAGAAGGAGGTGTAGGG - Intergenic
1165007708 19:32820028-32820050 CTCAGTGAGTGTGAGGAGGAAGG + Intronic
1165363346 19:35350190-35350212 AGGAAGGAGCGGGAGGAGGAAGG - Intergenic
1165431646 19:35776332-35776354 ATGAATGAGCGGGAGCAGCATGG - Intronic
1165840008 19:38783044-38783066 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166393072 19:42420893-42420915 AAGAGAGAGAGAGAGGAGGATGG - Intronic
1166631141 19:44409123-44409145 ATGCATCAGAGTCAGGGGGAGGG + Intergenic
1166815487 19:45542254-45542276 CTGAATGACTGTGTGGAGGAGGG + Intronic
1167716647 19:51146611-51146633 AAGAATGGGAGGGAGGAGGAAGG - Intronic
1167793404 19:51694080-51694102 AGGATGGAGAGTCAGGAGGATGG + Intergenic
1167937855 19:52922427-52922449 GAGAATGAGGGAGAGGAGGAGGG - Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925439903 2:3876516-3876538 GAGAGTGAGGGTGAGGAGGATGG + Intergenic
925572027 2:5322672-5322694 ATGAATGAGGTCGAGGGGGATGG + Intergenic
926831118 2:16963148-16963170 ATGTCTGAAAGTGAGGAGAATGG + Intergenic
928116211 2:28546692-28546714 ATGAATGGAAGCAAGGAGGATGG + Intronic
928411985 2:31061378-31061400 TTAAATGAGAGAGAGGAAGAGGG - Intronic
928644009 2:33332739-33332761 ATTAATGAGAGGGAGGAGGAGGG + Intronic
928921872 2:36535095-36535117 ATGAAGGAGAGAGGGAAGGAGGG + Intronic
929412830 2:41716466-41716488 ATTAATGAGAGAGAGGGTGACGG + Intergenic
930035850 2:47084560-47084582 AGGCCTGAGAGAGAGGAGGAAGG + Intronic
930059788 2:47278629-47278651 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
930240103 2:48927485-48927507 ATGAATGTGTGTGAGGATGTGGG + Intergenic
930539353 2:52685642-52685664 ATGAAAGAAAGTAAAGAGGATGG + Intergenic
930833432 2:55770061-55770083 AAGAAAGAGAGAGAGGAGGAAGG - Intergenic
931083015 2:58796849-58796871 ATTAATGAGAGTAAGAAAGATGG - Intergenic
931095122 2:58931019-58931041 GTGAAAGAAAATGAGGAGGAGGG - Intergenic
931259042 2:60600658-60600680 CTTACTGTGAGTGAGGAGGAGGG - Intergenic
931515568 2:63048962-63048984 AAAAATGAGAGAGAGAAGGAGGG - Intergenic
931692626 2:64848161-64848183 ATTAAGGGGAGGGAGGAGGAGGG + Intergenic
931925837 2:67071535-67071557 GTGAAAGAGAGTGAGGAAGGAGG - Intergenic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
932625925 2:73295866-73295888 CTGCCTGAGAGGGAGGAGGAGGG + Intergenic
932690423 2:73908402-73908424 CTGTAGGAGAGTGAAGAGGAGGG + Intronic
932980808 2:76663486-76663508 ATGGATGGGAGTGATAAGGATGG + Intergenic
933069337 2:77837071-77837093 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
933337381 2:80975623-80975645 AGGAAAGAGAGAGAGAAGGAAGG - Intergenic
933402854 2:81820754-81820776 ATCAATGAGAGGGAAAAGGAAGG - Intergenic
933585679 2:84177369-84177391 ATGAATGAGAATTTGGGGGAGGG + Intergenic
933653996 2:84872509-84872531 AAGAAAGAGAGAGAGAAGGAAGG + Intronic
933803170 2:85979078-85979100 AAGAATGAGAAAGAGAAGGAAGG - Intergenic
934124214 2:88870716-88870738 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
934169422 2:89327230-89327252 ATGACTGTGAGGAAGGAGGAAGG + Intergenic
934197872 2:89855355-89855377 ATGACTGTGAGGAAGGAGGAAGG - Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934513046 2:94963454-94963476 ATAAAAAAGGGTGAGGAGGACGG + Intergenic
934565947 2:95341240-95341262 AAGAAAGAGAGTGAGGGGGGAGG - Intronic
934666434 2:96174543-96174565 ATGAATGAAAGAGAGGAAGTGGG - Intergenic
934674844 2:96242254-96242276 ATGGATGAGAGGGAGGTGGGTGG - Intergenic
934704616 2:96468167-96468189 ATGTAGGTGAGTGAGGAGAAAGG - Intergenic
934854305 2:97719352-97719374 GGGAAGGAGAGTGAGCAGGATGG + Intronic
935020019 2:99221400-99221422 GTGAATGTAACTGAGGAGGAGGG - Intronic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
936523027 2:113223916-113223938 ATGAATGAAAGTGTGAATGATGG + Intronic
936838815 2:116743365-116743387 GTTAATGAGACTGAGGGGGATGG + Intergenic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937283734 2:120736984-120737006 AGGGATGAAAGTGAGGTGGAAGG - Intronic
937686443 2:124703198-124703220 AAGAAAGAGAGGGAGAAGGAAGG - Intronic
937686448 2:124703228-124703250 AAGAAAGAAAGGGAGGAGGAAGG - Intronic
937701980 2:124873194-124873216 AGGAAGAAGAGCGAGGAGGAAGG + Intronic
937777500 2:125797241-125797263 ATGAAAGAAAGAGAGAAGGAAGG + Intergenic
938201520 2:129376624-129376646 ATGAATGACGGTGAGGATCACGG + Intergenic
938928617 2:136066635-136066657 ATGGATGAGGGTGAGGTGGATGG + Intergenic
939821901 2:146967826-146967848 AAGAATGAGAGGCTGGAGGATGG - Intergenic
939875656 2:147574475-147574497 ATGTGTGAGAGTGAGGGGTATGG - Intergenic
940106917 2:150111477-150111499 ATGATGGAGTGGGAGGAGGAAGG - Intergenic
941282282 2:163567919-163567941 AGGAAGGAGAGAGAGAAGGAGGG + Intergenic
941364835 2:164597713-164597735 AGGAGTGAGAGAGAGGAAGAAGG + Intronic
941451625 2:165666865-165666887 AAGAAAGAGAGAGAGGAAGAAGG + Intronic
942365382 2:175220811-175220833 AAGAAAGAGAGAGAGGAGGAGGG - Intergenic
942602147 2:177652450-177652472 AGGAAGGAGAGAGAGGAGGTGGG + Intronic
942971941 2:181967659-181967681 AGGAAAGAGAGAGAGAAGGAGGG - Intronic
943033914 2:182716626-182716648 GTGAATAACAGGGAGGAGGAAGG - Intronic
944225153 2:197342093-197342115 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
944229218 2:197376404-197376426 ATAAATGAGAGTAGGGAGGAAGG + Intergenic
944329281 2:198446023-198446045 ATGAATGAAAATGAAGAGAATGG + Intronic
944381266 2:199113568-199113590 GAGAATGAGAGTGAGAAGAAAGG - Intergenic
944794379 2:203167837-203167859 GTGAATGAGAGAGGGGAGGAAGG - Intronic
945018215 2:205542479-205542501 ATGAATGAAGTTGAGGAGAAAGG - Intronic
945140725 2:206683666-206683688 ATGATTGAGTGGGATGAGGAAGG - Intronic
945294443 2:208156932-208156954 ATGTGAGAGAGTGAGGAGAAAGG - Intergenic
945333537 2:208565926-208565948 AGAAATGGGAGAGAGGAGGATGG + Intronic
945379285 2:209120423-209120445 AGGATCGAGAGTGATGAGGAGGG + Intergenic
945950465 2:216034532-216034554 GTGAAGGAGAGAGAGGAGGAAGG - Intronic
946042704 2:216796105-216796127 ATGAAGGACAGAGGGGAGGAAGG - Intergenic
946558775 2:220889536-220889558 ATGGAAGACAGTGAGGAGGAGGG - Intergenic
946742013 2:222812017-222812039 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
946876890 2:224138469-224138491 AGGAACAAGAGTGAGGAGGGAGG + Intergenic
947272112 2:228347928-228347950 AGGAAGGAGAGAGAGAAGGAAGG - Intergenic
947286757 2:228525329-228525351 AAGAATGAGAGGGAGGAGGGAGG + Intergenic
947393672 2:229666145-229666167 ATGAATGAATGTGGGGAGGCAGG - Intronic
947973511 2:234344409-234344431 AGGAAAGAAAGTGAGGAGGTGGG - Intergenic
947991635 2:234492717-234492739 GTAAATGAGAGTGCTGAGGAAGG + Intergenic
948155216 2:235776213-235776235 ATGAATGAGAGTGACAAGGGAGG + Intronic
948257213 2:236577192-236577214 CTGAATGAGAGAGCGGAGGCTGG - Intronic
948578800 2:238970558-238970580 GTGATTGAGAGAGAGGAGGAGGG - Intergenic
948748189 2:240110725-240110747 GAGAAGGAGAGTGGGGAGGAGGG - Intergenic
948786947 2:240357653-240357675 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
948814255 2:240501923-240501945 AGGAAGGAGAGTGAAGACGATGG - Intronic
1168790452 20:572559-572581 ATGAATGAAGGTAAGAAGGAAGG - Intergenic
1168838042 20:890745-890767 AGGAATGAGAGTGTGGTGGCAGG - Intronic
1169197757 20:3692616-3692638 AGGAATGAGAGTGAGGCAGCTGG + Exonic
1169554594 20:6735950-6735972 GAAAATGAGAGAGAGGAGGAAGG - Intergenic
1169773604 20:9228311-9228333 ATGAGAGAGAGTAAGGAAGAAGG + Intronic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1170760983 20:19251499-19251521 ATGAAACAGAGTGAGGGGAAAGG + Intronic
1170830039 20:19832323-19832345 GTAAAGGAGAGTGGGGAGGAAGG - Intergenic
1171134566 20:22684905-22684927 CTGTAAGAGAGTGAGGAAGAGGG + Intergenic
1171307274 20:24117204-24117226 ATGAGAGAGGGGGAGGAGGAAGG + Intergenic
1171422900 20:25030746-25030768 ATCAATGATGGTGAGGAGGTGGG - Exonic
1171862420 20:30412998-30413020 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
1171901775 20:30865220-30865242 AAGAATGAGAGAAAGAAGGATGG + Intergenic
1172124249 20:32615916-32615938 ATGAATGGGAGGGTGAAGGATGG + Intergenic
1172238680 20:33396702-33396724 AGGAATGACAGAGAGGAGCAAGG + Intronic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1172797582 20:37551996-37552018 ATGAAAGAAATTGAAGAGGAAGG - Intergenic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1173064391 20:39696252-39696274 AAGAGAGAGAGGGAGGAGGAGGG + Intergenic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173317634 20:41959397-41959419 AGGAAAGAGATTGATGAGGAGGG - Intergenic
1173531653 20:43774250-43774272 ATGAAAGAGAGAGAGGAGATGGG + Intergenic
1173575044 20:44107508-44107530 AGGAAAGAGAGTATGGAGGATGG - Intergenic
1173670643 20:44796405-44796427 AGGAAATAGAGTGGGGAGGAAGG + Intronic
1173894894 20:46543178-46543200 AGGAATGAGAGAGAGAGGGAGGG - Intronic
1173937615 20:46880939-46880961 TTGCCTGAGAGTGAGGAGGTGGG + Intergenic
1174390597 20:50216409-50216431 AAGATTCAGAGTCAGGAGGAAGG + Intergenic
1175453845 20:59094823-59094845 CTCAATGAGAGTAAGGAGGCGGG - Intergenic
1175463018 20:59168628-59168650 CTGAATGAGAGTGATGAGAGTGG + Intergenic
1175502397 20:59459888-59459910 GAGACTGTGAGTGAGGAGGAAGG - Intergenic
1175566833 20:59986477-59986499 AAGAAAGAGAGTCAGGAGAAAGG - Intronic
1175894352 20:62329512-62329534 AGGAAGGAGAGGGAAGAGGAAGG - Intronic
1176333524 21:5574089-5574111 ATGAATAGGAGTGGGGAGAAAGG + Intergenic
1176394233 21:6246863-6246885 ATGAATAGGAGTGGGGAGAAAGG - Intergenic
1176467186 21:7069311-7069333 ATGAATAGGAGTGGGGAGAAAGG + Intronic
1176490747 21:7451089-7451111 ATGAATAGGAGTGGGGAGAAAGG + Intergenic
1176509895 21:7687294-7687316 ATGAATAGGAGTGGGGAGAAAGG - Intergenic
1177177136 21:17712340-17712362 ATGAAAGAGAAAGAGGGGGAGGG - Intergenic
1178063524 21:28877420-28877442 AAGAAAGAGAGAGAGAAGGAAGG + Intronic
1179156521 21:38856406-38856428 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179732022 21:43373360-43373382 AAGAGGGTGAGTGAGGAGGAGGG - Intergenic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1180335150 22:11571172-11571194 AAGAATGAGAGAAAGAAGGATGG + Intergenic
1180413460 22:12637686-12637708 AGGAAGGAGAGAGAGAAGGAGGG + Intergenic
1181085350 22:20437168-20437190 GGGAGTGGGAGTGAGGAGGAAGG - Intronic
1181094535 22:20496285-20496307 AGGAATGAGAGAGTGAAGGAGGG - Intronic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1181347996 22:22234382-22234404 ATGAGAGAAAGAGAGGAGGAGGG + Intergenic
1183728321 22:39601945-39601967 AAGAAAGAGAGAGAGAAGGAAGG - Intronic
1183728341 22:39602024-39602046 AAGAAAGAGAGAGAGAAGGAAGG - Intronic
1183782018 22:40005021-40005043 ATGATTGAAAGTGATCAGGAGGG - Intronic
1183940352 22:41291190-41291212 ATGAAAGAGATTGAAAAGGATGG + Intergenic
1184412308 22:44332256-44332278 AGGAAGGAAAATGAGGAGGAAGG - Intergenic
1184589195 22:45470245-45470267 ATAAAGGAGAGTGTGGAGCATGG - Intergenic
1184978535 22:48080287-48080309 GGGAATGAGAGTGAAGAGGGAGG + Intergenic
1185024510 22:48400606-48400628 GTGACAGAGAGAGAGGAGGAAGG + Intergenic
1185144211 22:49121149-49121171 ATGAATGAGAGTTATCAGTAAGG - Intergenic
1185220729 22:49627962-49627984 ATGAATGGGAGTGAGGCGGGGGG + Intronic
949211597 3:1509716-1509738 AACAGTGAGAGTGAAGAGGAAGG - Intergenic
949986494 3:9545265-9545287 AGGAAAGAGGGAGAGGAGGAGGG + Intronic
950011393 3:9726713-9726735 ATGTTTGAGGGTGAGTAGGAAGG + Exonic
950259135 3:11531276-11531298 ATGAATGTGAGTGTGGGGCAGGG + Intronic
950902541 3:16511131-16511153 ATGACTGAGAATGAGGATGAAGG + Intronic
951475304 3:23099148-23099170 ATGAGTGAGATTGAAAAGGAAGG + Intergenic
952030552 3:29137108-29137130 ATGAATAAGAGTGGTTAGGAAGG + Intergenic
952376492 3:32772037-32772059 ATGAATGAGAGAGATTAGAAGGG + Intronic
952387847 3:32855705-32855727 CTGGCTGAGAGAGAGGAGGAAGG + Intronic
952449125 3:33414274-33414296 AAGAAAGAGAGGGAGGAGGGCGG + Intronic
952604625 3:35130128-35130150 AAGAATGAGAGTGAAGTGGAGGG + Intergenic
953000431 3:38927718-38927740 AAGAATGAGAGTGAAGCGAAGGG + Intronic
953435267 3:42872790-42872812 ATGAAGGTGAAAGAGGAGGAGGG + Exonic
953782246 3:45881493-45881515 GTGAGAGAGAGAGAGGAGGAGGG - Intronic
954124330 3:48519870-48519892 ATGAACCACAGTGATGAGGACGG - Intronic
954166478 3:48762968-48762990 AGGAATGTGAGTGTGGGGGAGGG + Intronic
954498788 3:50989852-50989874 ATAATTGAGAGTCAGGAGGATGG + Intronic
954615078 3:51965386-51965408 TTGACAGAGAGTGGGGAGGATGG - Intronic
954834808 3:53456696-53456718 AGGGGTGAGAGTGAGGAAGAGGG + Intergenic
955068449 3:55552413-55552435 AAGAATGAGGGGGAGGAAGAAGG - Intronic
955146581 3:56326032-56326054 AAGAAGGAGAGTGAGGAGTAGGG - Intronic
955410529 3:58652706-58652728 ATGAATGAGTGGGTGGAGAATGG - Intronic
955536001 3:59924313-59924335 ATGGATGGGAGGGAGGAAGAGGG - Intronic
955808149 3:62758175-62758197 ATGAAGGAGAGTGAGACTGATGG - Intronic
955907289 3:63820489-63820511 GGGGATGAGAGTGGGGAGGATGG + Intronic
956893352 3:73635014-73635036 ATGAATGGCTGTAAGGAGGATGG + Intergenic
957286929 3:78229271-78229293 AAGATTGAAAGTTAGGAGGAGGG - Intergenic
957433760 3:80148372-80148394 TTGAATGAGAGTGGTGAGAAAGG + Intergenic
957831002 3:85518748-85518770 CTTAATGAGAGTGTGGAAGAGGG - Intronic
957891182 3:86361312-86361334 AGGAGTGAGAGTGGGGAGGCAGG - Intergenic
958734760 3:97995616-97995638 AAGAATTAGAGTGGAGAGGAGGG + Intronic
958841165 3:99207282-99207304 ATGATTGAGAGTAGAGAGGAAGG + Intergenic
959217450 3:103470023-103470045 ATAAATGAGAGAGAGAAAGAGGG + Intergenic
959412008 3:106036037-106036059 ATGAATGGGGGTTAGGAGGTGGG + Intergenic
960034792 3:113091633-113091655 ATGAATGAAAGAAAGAAGGAGGG + Intergenic
960263564 3:115595175-115595197 AAAAATGTAAGTGAGGAGGAGGG - Intergenic
960337663 3:116437640-116437662 AAGAATTGGAGGGAGGAGGAAGG + Intronic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960409739 3:117308305-117308327 ATGAATGGGAGGGATGAGGAAGG + Intergenic
960740656 3:120830029-120830051 TAGAATGTGAGGGAGGAGGAGGG - Intergenic
960833005 3:121870373-121870395 ATGGATGAGGGTGAGAGGGAGGG + Intronic
960875873 3:122294884-122294906 AGGAAGGAGAGAGGGGAGGAAGG + Intergenic
961095138 3:124148042-124148064 ATTAATGAAAGTGGGAAGGATGG + Intronic
961221691 3:125206032-125206054 ATGAATGCAGCTGAGGAGGAAGG - Intronic
961408686 3:126703070-126703092 ATGATTGAGAGAGAGCAGTAAGG - Intergenic
961578215 3:127855873-127855895 GGGAATGAGAGAGAGGGGGAAGG + Intergenic
961629723 3:128287399-128287421 ATGGGAGAGAGTGAGGAGGCTGG + Intronic
961828009 3:129608557-129608579 GAGGATGTGAGTGAGGAGGAGGG - Intergenic
961951025 3:130749189-130749211 AGGAATGAGTGTGGTGAGGAAGG - Intergenic
961978931 3:131056068-131056090 ATGAATGAGGGTGGGGAGAAGGG + Intronic
962096008 3:132293442-132293464 GAGAAAGAGAGTGAGGGGGAAGG + Intergenic
962139745 3:132776567-132776589 ATGAATGAGATACAGTAGGATGG + Intergenic
962290642 3:134133842-134133864 ATGAATGGCAGTGATGATGATGG + Intronic
962361148 3:134743799-134743821 ATGGAAGAGTGTCAGGAGGAAGG - Intronic
962584787 3:136831160-136831182 ATGAATGAGGCTGCTGAGGAGGG + Intronic
962878598 3:139554785-139554807 AGAAAGGAGAGAGAGGAGGAAGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963193021 3:142494702-142494724 ATGAATGACACTGAGGAAGTAGG + Intronic
963237139 3:142966980-142967002 AAGAAGGAGAGAGAGAAGGAAGG + Intronic
963926702 3:150958536-150958558 ATGCGTGAGAGTGTGGAGGAGGG - Intronic
964281584 3:155072241-155072263 ATTGATGGGAATGAGGAGGATGG - Intronic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964767159 3:160190270-160190292 AAGATTGGAAGTGAGGAGGAGGG + Intergenic
965189321 3:165507670-165507692 AAGAATGAGAGTGAAGTGAAAGG + Intergenic
965279559 3:166731770-166731792 AGGAAAGAGAGAGAGAAGGAAGG + Intergenic
965322321 3:167265472-167265494 ATGAAAGAGAGTGAAGAGTAAGG - Intronic
965957985 3:174394704-174394726 AGGAAAGAGAGTGGGAAGGAAGG + Intergenic
966101680 3:176276881-176276903 AGGAAGGAGAGTGACTAGGAAGG - Intergenic
966142278 3:176769723-176769745 AAGAAAGAGAGAGAGGAGGGAGG + Intergenic
966815983 3:183890242-183890264 GTGTATGAGAGTGAGCTGGAGGG - Intergenic
967473500 3:189889747-189889769 AAAAATGTGAGAGAGGAGGAAGG - Intronic
968914442 4:3491156-3491178 ATGAATGAGCAGGAGGAAGAAGG - Intronic
969104439 4:4794612-4794634 AGGATGGAGAGGGAGGAGGAAGG - Intergenic
969109049 4:4829906-4829928 ATGAAAGAGAGTCAGCAGGGAGG + Intergenic
969126440 4:4951733-4951755 ATGAAAGAGAATGAGGACGTGGG - Intergenic
969480826 4:7446015-7446037 ATGAAAGAGGGAGAGAAGGAAGG - Intronic
971098219 4:23432959-23432981 AATAATGAGAGTGAAGAGAATGG - Intergenic
971709671 4:30094329-30094351 AGGAAGGAGAGAGGGGAGGAAGG + Intergenic
971756745 4:30717560-30717582 AGGAATGAGAGTGAGGAGGGCGG + Intergenic
971932405 4:33101885-33101907 ATGAAAGAAAGAAAGGAGGAAGG - Intergenic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
972648725 4:40994852-40994874 AGGAAGGAGAGAGAGAAGGAGGG + Intronic
972789502 4:42357398-42357420 ATGAAAGAGAGAGAGAGGGAGGG + Intergenic
972874621 4:43343445-43343467 ATGAAGGAAAGGAAGGAGGAAGG - Intergenic
972939145 4:44176210-44176232 ATAAATCAGAATCAGGAGGAAGG + Intronic
973278891 4:48339125-48339147 GTGAAAGAAAGTGAGGAGTAGGG + Intergenic
973345921 4:49055551-49055573 ATGAAAGAGTTTGAGAAGGATGG + Intronic
973599567 4:52528668-52528690 AAGAAAGAGAGAGAAGAGGAAGG + Intergenic
974112873 4:57545513-57545535 ATGTGTGAGAGTGATGGGGAGGG + Intergenic
974595161 4:64004628-64004650 AGGAATGAAAGTGAGGGGGGAGG - Intergenic
974890196 4:67872272-67872294 AAGAATGAAAGAAAGGAGGAAGG - Intronic
974928852 4:68337299-68337321 AACACTGAGAATGAGGAGGAAGG - Exonic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
975481069 4:74880933-74880955 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
975504425 4:75122672-75122694 AAGAAGGAGGGAGAGGAGGAGGG + Intergenic
975509520 4:75178286-75178308 AGGGATGAGAGAGAGGAGGAAGG - Intergenic
975516934 4:75258167-75258189 AGGAATGAGAGTGAGAGGGTAGG + Intergenic
975536928 4:75460727-75460749 AGGAAGGAAAGTGGGGAGGAAGG + Intergenic
976332517 4:83849133-83849155 CAAGATGAGAGTGAGGAGGAGGG + Intergenic
976999562 4:91480952-91480974 GTGAGTGAGAGAGAGGAAGAGGG + Intronic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
980080739 4:128341294-128341316 AGGAAAGAGAGAGAGGATGAAGG - Intergenic
980531441 4:134060886-134060908 AAGATAGAGAGTGAGAAGGATGG + Intergenic
980749751 4:137072733-137072755 ATGAGAGAGAGTGAGAAAGACGG - Intergenic
981027989 4:140095583-140095605 AAGAAGGGCAGTGAGGAGGATGG - Intronic
981598066 4:146449582-146449604 ATGAATGAGAGAGAACAGGATGG - Intronic
981791854 4:148546516-148546538 ATGAATGAGTGAGTAGAGGAAGG + Intergenic
982115799 4:152097422-152097444 AAGAATGAGAGAAAGAAGGAAGG + Intergenic
982309708 4:153972108-153972130 ATGACTCAGGGTGAGGAGGTTGG + Intergenic
983163274 4:164444110-164444132 CTGAATGAGGGTGAAGGGGAAGG - Intergenic
983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG + Intergenic
984019496 4:174467866-174467888 AGGTAGGAGAGTGAGGAGGATGG - Intergenic
984496781 4:180507810-180507832 ATGGTTGAGAGTGAGAAGGATGG + Intergenic
985264456 4:188145062-188145084 TTCAATGAAATTGAGGAGGAAGG + Intronic
985336971 4:188906164-188906186 AAGAAAGGGAGGGAGGAGGAAGG - Intergenic
985957442 5:3276085-3276107 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957453 5:3276117-3276139 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957461 5:3276149-3276171 ATGAAGGAGGGAGAGGATGAAGG + Intergenic
985957468 5:3276165-3276187 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957479 5:3276196-3276218 ATGAAGGAGGGAGAGGATGAAGG + Intergenic
985957486 5:3276212-3276234 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957497 5:3276244-3276266 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957508 5:3276276-3276298 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957519 5:3276308-3276330 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957550 5:3276388-3276410 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957561 5:3276420-3276442 ATGAAGGAGGGAGGGGAGGAAGG + Intergenic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986066176 5:4236429-4236451 ATGAATGTGATTTAGGATGAGGG - Intergenic
986293995 5:6422516-6422538 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
987359394 5:17093026-17093048 ATGAATGAGGGAGAGAAGGAAGG + Intronic
987380942 5:17285438-17285460 GTTAATGAGAATGTGGAGGAAGG + Intergenic
987430241 5:17824181-17824203 TTGAATAAGAGTGATGAGGGAGG - Intergenic
987601728 5:20080721-20080743 AAGAAGGGGAGAGAGGAGGAGGG + Intronic
987874338 5:23660365-23660387 CAGAATGGGAGTGAGGAGGTGGG + Intergenic
988128606 5:27074518-27074540 ATCATTGAGATTCAGGAGGATGG + Intronic
988453100 5:31362867-31362889 AGGAAGTGGAGTGAGGAGGAAGG - Intergenic
988912417 5:35856905-35856927 ATGAATGAGAGTAAGAGGAAGGG - Exonic
988990534 5:36666104-36666126 TAGGAAGAGAGTGAGGAGGAGGG - Intronic
989244700 5:39241501-39241523 AGGAAGGAGAGGTAGGAGGAAGG - Intronic
989248650 5:39282031-39282053 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
989362380 5:40617492-40617514 AGGGAAGAGAGTTAGGAGGATGG + Intergenic
989403070 5:41029810-41029832 GGGAGTGAGAGTGAGGAGTAAGG + Intronic
989981940 5:50655767-50655789 ATGAAAGAGAGAAGGGAGGAAGG - Intergenic
990485644 5:56257296-56257318 AAGAAAGAGAGGGGGGAGGAAGG - Intergenic
990574259 5:57109468-57109490 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
991379897 5:66009361-66009383 ATGAATGAGAGAAAAGAAGATGG + Intronic
991476786 5:67029727-67029749 AAGAATGAAAGTGAGGTGGATGG + Intronic
992259299 5:74953851-74953873 ATAAATGATAGTGAGGGTGAGGG - Intergenic
992547273 5:77825631-77825653 ATGCAAGACAGTGTGGAGGATGG - Intronic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
992752582 5:79874829-79874851 ATGAAGGAGAGATGGGAGGAAGG - Intergenic
993256593 5:85599370-85599392 AGGAATGTGAGTGAGGAAGTAGG - Intergenic
993407527 5:87529885-87529907 AGGAAGGAGAGAGAGAAGGAGGG - Intergenic
993407952 5:87535508-87535530 AAGAAAGAGAAAGAGGAGGAAGG - Intergenic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
994202040 5:96988137-96988159 AAGAGAGAGAGTGAAGAGGAAGG - Intronic
994990090 5:106984885-106984907 AAGAAAGAGAGTGAGTAGTATGG - Intergenic
995219740 5:109634553-109634575 ATCACTGAGAGTCAGGAGAATGG + Intergenic
995348550 5:111148888-111148910 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
995613976 5:113940754-113940776 ATGAATGCGAGTGTGGGTGATGG + Intergenic
995907468 5:117142823-117142845 GAGAATGAGAGATAGGAGGATGG - Intergenic
996300165 5:121972356-121972378 TTGAAAGAGAGAAAGGAGGACGG + Intronic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
996479956 5:123964386-123964408 AAGAAAGAGAGAGAGGAGGGAGG - Intergenic
997509240 5:134442040-134442062 ATGAATGTGACTGGGGAGCAGGG + Intergenic
997592990 5:135086920-135086942 CTAAAGGAGAGGGAGGAGGAGGG + Intronic
997898283 5:137739903-137739925 AGGCAAGAGAGTGAGGAGGAAGG - Intergenic
998205285 5:140153209-140153231 AGGAGAGAGAGAGAGGAGGAGGG - Intergenic
998458926 5:142295150-142295172 ATGAAAGAGCGTGAGAAGGGTGG - Intergenic
998996987 5:147876613-147876635 AGGAATGAAAGTGAAGAGAAAGG + Intronic
999652365 5:153779915-153779937 ATTAAAGAGAGAGAGGAGGAAGG + Intronic
999686133 5:154104932-154104954 AAGACAGAGAGTGACGAGGAGGG + Intronic
1000242785 5:159424060-159424082 AAGCATGAGAGAGAAGAGGAAGG + Intergenic
1000265399 5:159631562-159631584 AAGAAAGACAGAGAGGAGGAAGG - Intergenic
1001108370 5:168875129-168875151 AAGAATGAGAGGGAGGAAGGAGG + Intronic
1001132897 5:169079510-169079532 AAGGAGGAGAGGGAGGAGGAAGG + Intronic
1001321520 5:170686344-170686366 GAGAATGAGAGAGAGGGGGAGGG + Intronic
1001422786 5:171600036-171600058 ATGAAGGATAGTGAATAGGATGG + Intergenic
1001482917 5:172100882-172100904 ATGAATGAAAGAGAGAGGGAGGG - Intronic
1001758010 5:174185732-174185754 ATGAGTGAGAGAGAGGAGATGGG + Intronic
1001926534 5:175640948-175640970 GAGAATGAGAGAGAGCAGGATGG - Intergenic
1002666924 5:180831740-180831762 GTGCCTGAGAGAGAGGAGGAAGG - Intergenic
1003033335 6:2621546-2621568 GAGAATGAGAGTGAGGTGGAAGG - Intergenic
1003548202 6:7078991-7079013 ATGAATGGGAGAAAGAAGGAAGG + Intergenic
1003658633 6:8039283-8039305 AGGAAGTATAGTGAGGAGGAGGG + Intronic
1003707151 6:8545604-8545626 AGAAGTGAGAGTGATGAGGAGGG - Intergenic
1003712232 6:8605077-8605099 AAGAATGAGAGGGAGGAGAAAGG - Intergenic
1003939441 6:11009682-11009704 ATGAAAGCCAGTGAGGACGACGG + Intronic
1004198805 6:13529339-13529361 TTGAATGGGATTGAGGAGGGAGG + Intergenic
1004258235 6:14084703-14084725 ATGAATGAGACAAAGGAGGTGGG + Intergenic
1004772180 6:18796362-18796384 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1004842873 6:19606722-19606744 AAGAAAGAGAGAGAGAAGGAAGG + Intergenic
1006066433 6:31465630-31465652 ATGGATGAGTAAGAGGAGGAAGG - Intergenic
1006149532 6:31979224-31979246 AGGAAGGAGGGGGAGGAGGAGGG + Intronic
1006195661 6:32240329-32240351 AAAAAAGAAAGTGAGGAGGATGG + Intergenic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1006882801 6:37354364-37354386 ATGAATGGCAGAGAGGAGGCGGG + Intronic
1007043522 6:38748314-38748336 ATGAATGACATTGAGGAGGGAGG + Intronic
1007180456 6:39925857-39925879 ATGAATGGGAATGTGGAGGGAGG + Intronic
1007218875 6:40262763-40262785 ATGACTGAGATGGTGGAGGAAGG + Intergenic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007242599 6:40437956-40437978 ATAAATGAAAGTGGGCAGGAGGG + Intronic
1007364030 6:41377714-41377736 ATGAATGAGATTGAGGACTAGGG - Intergenic
1007444367 6:41894379-41894401 AGGAATAAGAGTGTGGTGGAAGG - Intronic
1007622425 6:43223214-43223236 ATGGATGAGAATGAGAAGGGAGG + Intronic
1007724239 6:43905225-43905247 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1008514621 6:52307376-52307398 AGGAGTGAGAGTGGGGAGGCCGG - Intergenic
1009476989 6:64105027-64105049 ATGAATGAGAGAGAGGGGGCGGG + Intronic
1009567306 6:65325205-65325227 ATGAAGAAGGGAGAGGAGGAGGG - Intronic
1009647943 6:66432224-66432246 AAGAATGAAAGTGAGGAGCAAGG - Intergenic
1009786819 6:68350981-68351003 ATGAATGAGTGTGATGAAGTTGG - Intergenic
1009940624 6:70283624-70283646 GCGAAAGAGAGTGGGGAGGAGGG + Intronic
1010062351 6:71637726-71637748 TTGAATAAGAGTGATGAGAATGG - Intergenic
1010082054 6:71874939-71874961 ATGTATGAGGGTGAGGTGAAAGG + Intergenic
1010752498 6:79631247-79631269 GGGAAGGAGAGGGAGGAGGAGGG - Intergenic
1011027449 6:82884778-82884800 ACGAATGGAAGGGAGGAGGACGG + Intergenic
1011775326 6:90723961-90723983 ATAAATGAGTGTCAGGATGAGGG - Intergenic
1012372598 6:98525822-98525844 ATGAGTGAGAGTGAAGGTGATGG - Intergenic
1013291334 6:108721280-108721302 ATGATTGAGAGGGAGGATGGGGG - Intergenic
1013474919 6:110498176-110498198 TTGAAAGAGAGTGGGGAGGGAGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014724005 6:124954267-124954289 AGGAAGGAGAGAGAGGAGAAGGG - Intergenic
1015031011 6:128595955-128595977 ATGAAAGACTGAGAGGAGGAGGG + Intergenic
1015304601 6:131693829-131693851 ATAGATGAGAATGAGGAGTAAGG + Intronic
1015874450 6:137808853-137808875 CCGAATGAGAGGGAGGAAGATGG + Intergenic
1015988560 6:138911656-138911678 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988569 6:138911699-138911721 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1015988578 6:138911742-138911764 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988588 6:138911785-138911807 ATGTGTGAGGGAGAGGAGGAGGG + Intronic
1015988602 6:138911874-138911896 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1016420815 6:143881077-143881099 ATGAGTGGGAGTGGGGTGGAAGG - Intronic
1016848799 6:148595347-148595369 AGGAATGACAATGAGGATGATGG - Intergenic
1017055763 6:150434356-150434378 ATGAATGAGTCGGAGGAGGTAGG + Intergenic
1017081816 6:150676907-150676929 ATGAAGGAGAGGGAGGAGGGAGG - Intronic
1017451057 6:154554763-154554785 TAGCATGGGAGTGAGGAGGAGGG - Intergenic
1017545769 6:155449634-155449656 AAGAAGGCGAGGGAGGAGGAGGG - Intronic
1017584573 6:155906433-155906455 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1017586973 6:155937240-155937262 AAGAATGAGAGAAAGAAGGAAGG - Intergenic
1017638718 6:156469215-156469237 AAGAAAGAGAGAAAGGAGGAGGG + Intergenic
1017645080 6:156532952-156532974 CTGAATGAGAGTTAGATGGATGG + Intergenic
1017735380 6:157358181-157358203 AAGATTGAGAGGGAGGGGGAGGG - Intergenic
1018137646 6:160793015-160793037 ATAAATGTGTGTGGGGAGGACGG - Intergenic
1018234500 6:161710897-161710919 AGGAAGGAAAGGGAGGAGGAAGG - Intronic
1018480297 6:164182949-164182971 ATGAAGCAGAGGGAGAAGGATGG - Intergenic
1019146228 6:169977125-169977147 CTGAATGAAAGAAAGGAGGAGGG - Intergenic
1019494968 7:1333463-1333485 AAGAAGGAGGGGGAGGAGGAGGG - Intergenic
1019495486 7:1337763-1337785 AAGAAGGAGAGAGAGGAGGGAGG - Intergenic
1019860237 7:3651994-3652016 ATGAATGAGTTTGAGGAAGAAGG + Intronic
1020193195 7:6016465-6016487 ATGAATGAGGGAGCAGAGGAAGG - Intronic
1020954836 7:14728253-14728275 ATGAAGGAGAATGAGGCTGACGG - Intronic
1020967192 7:14886020-14886042 AAAATTGATAGTGAGGAGGATGG + Intronic
1021095870 7:16535389-16535411 ATGAATGAGATAGAAGAGGAGGG + Intronic
1021426911 7:20510677-20510699 AAGAAAGAGAGTGTGAAGGATGG - Intergenic
1021445823 7:20732319-20732341 GGGAAAGAGAGTGATGAGGAGGG - Intronic
1021447511 7:20749212-20749234 AAGAAAGAGAGAGAGGGGGAGGG - Intronic
1021626636 7:22600042-22600064 ATAAATGACAGTGAGGAGAGAGG + Intronic
1021747152 7:23753352-23753374 ATGAGTGAGTGTGTGGATGAGGG + Intronic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022516382 7:30977379-30977401 CTGAGTGGGAGAGAGGAGGAGGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022796510 7:33735665-33735687 CTGAGTGTCAGTGAGGAGGATGG - Intergenic
1022828959 7:34045515-34045537 AAGAATGAGAATGAGGGGGCAGG + Intronic
1022905930 7:34856825-34856847 ATGATTGAGAGGCAGGAGGAGGG + Intronic
1023295059 7:38706465-38706487 GGGAATGGGAGTGTGGAGGAGGG - Intergenic
1023499444 7:40832052-40832074 ATGAAAGAAAGTGAGCAGTATGG + Intronic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024282010 7:47726179-47726201 ATGATTGAGTGAGAGGAAGAAGG + Intronic
1024971366 7:55074193-55074215 GTGACTCAGAGTGAGCAGGAAGG - Intronic
1025243908 7:57301536-57301558 ATGAAGGAGGCTGAGGTGGAAGG - Intergenic
1025561427 7:62377820-62377842 AAGAAGGAGAGAGAGGTGGAGGG + Intergenic
1025955499 7:66179603-66179625 AAGAATAAGAGTGAGTAGGCCGG + Intergenic
1026044203 7:66894573-66894595 AGGGAAGAGAGGGAGGAGGAAGG + Intergenic
1026124718 7:67569435-67569457 ATGAGTGGGTGGGAGGAGGAGGG - Intergenic
1026130451 7:67616394-67616416 ATGAAAAACAGTGAGGAAGATGG + Intergenic
1026469164 7:70680100-70680122 TTCCATGAGAGTGGGGAGGAGGG + Intronic
1026566895 7:71496608-71496630 ATGAGGGAGGGTGAGGAGGAAGG + Intronic
1026650036 7:72209121-72209143 ATGAAAGAGGGAGAGAAGGAAGG - Intronic
1026777749 7:73241521-73241543 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026967457 7:74449290-74449312 AAGAAAGAAAGAGAGGAGGAAGG - Intergenic
1027018600 7:74794913-74794935 ATGAGTGAGAGGGAGAAGGAGGG + Intergenic
1027069429 7:75151024-75151046 ATGAGTGAGAGGGAGAAGGAGGG - Intergenic
1028096928 7:86772445-86772467 AAGAATGGGAGTGAGGACGATGG - Intronic
1028213016 7:88098661-88098683 AGGAATAAAAGTGATGAGGAAGG - Intronic
1029178684 7:98683770-98683792 AGGAAGGAAAGTAAGGAGGAAGG - Intergenic
1029307100 7:99628467-99628489 AAGGATCAGAGTGAGGATGAAGG + Intronic
1029425606 7:100492299-100492321 AGGAATGAGAGTGAGGGGGTTGG + Intronic
1029907349 7:104104872-104104894 GGGAATGAGTGAGAGGAGGAAGG + Intergenic
1030015129 7:105211553-105211575 AGGAGTGAGAGTGAGGGGGGAGG + Intronic
1030200768 7:106901500-106901522 ATCATTGAGATTCAGGAGGATGG - Intronic
1030541652 7:110837732-110837754 ATGAATGGGGGTTGGGAGGAAGG + Intronic
1030598652 7:111568701-111568723 ATGAATGAGAGACAGAAGGCAGG - Intergenic
1030700685 7:112636566-112636588 ATGAAGGAGAGAGAGGAGTCTGG - Intergenic
1030771368 7:113478606-113478628 AATACTGAGAGTGAGGAAGAGGG - Intergenic
1030961318 7:115927224-115927246 ATGAAAGGGAGTTAAGAGGAGGG - Intergenic
1031425733 7:121603314-121603336 AAGAAAGAGAGAGAGAAGGAAGG - Intergenic
1031948150 7:127862734-127862756 ATGATTGAGAGTGTTGCGGATGG + Intronic
1032361797 7:131262887-131262909 ATGTATGTGAGTGTGGAGAAAGG - Intronic
1032523617 7:132563412-132563434 AGGAAGGAGAAGGAGGAGGAGGG - Intronic
1032715235 7:134503516-134503538 ATGACTGAGGGTGAAGAGGGAGG + Intergenic
1032729423 7:134623370-134623392 TTGAAGGAGAGTGTGGAGGGCGG + Intergenic
1032872397 7:136000391-136000413 ATGAATGAGTGAAAGGATGAAGG - Intergenic
1034360113 7:150488429-150488451 ATGTATGAGACTGAGGAACATGG + Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1035011324 7:155717954-155717976 ATGAAAGAGAGAAGGGAGGAAGG - Intronic
1035237606 7:157508974-157508996 GAGAAAGAGAGAGAGGAGGAGGG + Intergenic
1035241576 7:157534073-157534095 AGGAACGAGAGCCAGGAGGAAGG - Intergenic
1035242085 7:157538727-157538749 AGGACTGAGAATGGGGAGGAAGG + Intergenic
1035406240 7:158599536-158599558 ACTAATGAGGGGGAGGAGGATGG - Intergenic
1035667050 8:1387133-1387155 ATCATTGACAGTAAGGAGGATGG + Intergenic
1037086487 8:14857124-14857146 ATGAACAAGAGAGAGGAGGGAGG - Intronic
1037128838 8:15383671-15383693 ATGCATGAGGGGGAGGAGGGAGG - Intergenic
1037459179 8:19092269-19092291 ATGAATGAGAATTGGGAGGCAGG - Intergenic
1037743913 8:21628477-21628499 ATGAAAGAGAGGTAGGAAGATGG + Intergenic
1037760269 8:21737421-21737443 ATGAAGTAGAGTCAGGTGGAGGG - Intronic
1037829346 8:22178787-22178809 AGGAAGGAGTTTGAGGAGGAGGG - Intronic
1038214034 8:25545369-25545391 AAGAAAGAGAGTGAGGGGAAAGG + Intergenic
1038715899 8:29990819-29990841 GTGAATGAGACTGATGATGATGG + Intergenic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039461838 8:37751599-37751621 ATAAATGATAGTGAGGATTACGG - Intronic
1039874075 8:41570571-41570593 AAGAAAGAGAGAGAGGGGGAGGG + Intergenic
1039895292 8:41712852-41712874 AAGTAGGGGAGTGAGGAGGAGGG + Intronic
1039900443 8:41748458-41748480 ATGAAAGAGGGTGAGGATGGTGG - Intronic
1040399682 8:47036299-47036321 AAGAATGAGAGTGAGGTGGGAGG + Intergenic
1041177455 8:55211156-55211178 TTGAATGTGAGAGAGGAGAAAGG - Intronic
1041253001 8:55953078-55953100 AGGAATGGGAGGGCGGAGGAAGG - Intronic
1041348145 8:56922740-56922762 ATGCAGGAGACTGAGGAGGAAGG + Intergenic
1041561920 8:59227469-59227491 ATCATTGAGACTCAGGAGGATGG + Intergenic
1041896217 8:62927183-62927205 AGGCATGAGAGTGAGTGGGAGGG - Intronic
1042414148 8:68499999-68500021 GAGAAAGAGAGTGAGGAGGATGG - Intronic
1042517442 8:69674323-69674345 ATAAAAGAGAGAAAGGAGGAAGG + Intronic
1043229755 8:77787349-77787371 ATCATTGAGATTCAGGAGGATGG - Intergenic
1043600134 8:81927843-81927865 ATGTATTAGAGTGTGTAGGATGG + Intergenic
1043800260 8:84600682-84600704 ATGACTGAGAGGAATGAGGAGGG + Intronic
1043920706 8:85980252-85980274 AAGCAAGAGAGAGAGGAGGAGGG - Intergenic
1044024682 8:87154291-87154313 AAGAAGGAAAGTCAGGAGGAAGG + Intronic
1045451545 8:102331760-102331782 ATGAATTAGGGAGAGAAGGATGG - Intronic
1045474654 8:102542604-102542626 AAGAAGGAGGGGGAGGAGGAGGG - Intergenic
1046048274 8:108988636-108988658 CAGAAAGAGAGAGAGGAGGAAGG + Intergenic
1046057025 8:109091022-109091044 AAGAATGTGAGTGATGAGCAGGG + Intronic
1046740165 8:117819534-117819556 ATGAATGAAAGGGAGTAGCAGGG + Intronic
1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG + Intergenic
1048007624 8:130431988-130432010 AAGAAGGAGAGGGAGGAGAAAGG + Intronic
1048207494 8:132426854-132426876 ATGCATGAAAGTGAGGAAGTGGG - Intronic
1048357795 8:133667666-133667688 ATGAAGGGGAGGGAAGAGGAGGG - Intergenic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048525512 8:135198833-135198855 CTGACTGAGTGTGGGGAGGATGG - Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049352468 8:142171535-142171557 GTGAAGGAGAGTGGGGAGGGTGG - Intergenic
1049361125 8:142213009-142213031 ATTAGAGAGAGGGAGGAGGAGGG - Intronic
1050012562 9:1199944-1199966 CTGCATGAAAGTGAGGAAGAAGG + Intergenic
1050068986 9:1790838-1790860 AAGCAAGAGAGAGAGGAGGAGGG - Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050565574 9:6878744-6878766 ATGTATGTGTGTGATGAGGAAGG + Intronic
1050876784 9:10649504-10649526 ATGACTTAGTGTGAGGAGTAAGG + Intergenic
1051197734 9:14581570-14581592 TTGAATAAGAGTGGGGAGGCTGG - Intergenic
1051480429 9:17554168-17554190 AGGAAAGAGAGAGAGAAGGAAGG - Intergenic
1051540221 9:18207220-18207242 AGGAATGAGAGAGAGGAAAAAGG + Intergenic
1052122606 9:24737477-24737499 TTGAATGAGAGTTAGGATGAAGG - Intergenic
1052188238 9:25625217-25625239 GTGAATGAAGGTTAGGAGGAGGG - Intergenic
1052311483 9:27073829-27073851 ATCACTGAGATTCAGGAGGATGG - Intergenic
1052316613 9:27122369-27122391 AGGAGTGGAAGTGAGGAGGAGGG + Intronic
1052321254 9:27170097-27170119 AAGAATGAGAGTGAAGGAGAGGG + Intronic
1052683386 9:31723405-31723427 GAGAATCAGAGTGAGGGGGAAGG - Intergenic
1052692985 9:31838773-31838795 ATGGTAGAGAGTGAGGAGGAAGG + Intergenic
1052703141 9:31961356-31961378 ATCATTGAGATTTAGGAGGATGG + Intergenic
1052918196 9:33939982-33940004 AGGGAGGAGGGTGAGGAGGAGGG + Intronic
1053016955 9:34667317-34667339 AAGAATGAGAGGGAGAAAGAGGG - Intergenic
1053420958 9:37977821-37977843 GTGAAGGAGGGTGAAGAGGAAGG - Intronic
1053484714 9:38443011-38443033 ATGAATGAGTGAGTGAAGGAAGG - Intergenic
1053642740 9:40103029-40103051 ATAAATGAGAGTGAGAAAGCTGG - Intergenic
1053649875 9:40156654-40156676 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
1053755872 9:41307288-41307310 AGGAAGGAGAGAGAGAAGGAAGG - Intergenic
1053832152 9:42094725-42094747 AGGAAGGAGAAGGAGGAGGAAGG + Intronic
1054330382 9:63748416-63748438 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
1054534706 9:66219549-66219571 AGGAAGGAGAGAGAGAAGGAAGG - Intergenic
1054598393 9:67092699-67092721 AGGAAGGAGAAGGAGGAGGAAGG - Intergenic
1054720597 9:68599905-68599927 ATGAAGAGGAGAGAGGAGGATGG - Intergenic
1055739088 9:79366185-79366207 ATGACTGAAAGGGAGGATGAGGG + Intergenic
1055820133 9:80252558-80252580 AGGAGAGAGAGTGAGGAGAATGG + Intergenic
1055885549 9:81059441-81059463 AAGATTGGGAGTGAGGAAGAGGG - Intergenic
1056447778 9:86682880-86682902 GGGAATGAGAGTTTGGAGGAGGG - Intergenic
1056715883 9:89027797-89027819 ATAAAAGAGAGTGAGGAGGAGGG + Intronic
1057136987 9:92698437-92698459 ATCATTGAGATTCAGGAGGAAGG - Intergenic
1057299214 9:93867251-93867273 AGGGAAGAGAGTGGGGAGGATGG - Intergenic
1057456298 9:95215390-95215412 GGGAGAGAGAGTGAGGAGGATGG + Intronic
1057581784 9:96293578-96293600 GAGAAAGAGAGTGGGGAGGAAGG - Intronic
1057709241 9:97422566-97422588 ATGAATGGGAGTGCTGAGCATGG + Intronic
1057748068 9:97767611-97767633 AGGAAGGAGAGAGAGGAGGAAGG - Intergenic
1057936602 9:99244887-99244909 AGGAAATAGAGTGAGGAGAAGGG + Intergenic
1058117239 9:101098316-101098338 ATAAATGAGATGGGGGAGGAAGG + Intronic
1058187979 9:101877543-101877565 ATCAAGGAGTATGAGGAGGACGG + Intergenic
1058395972 9:104554839-104554861 GTGAACGAAATTGAGGAGGATGG + Intergenic
1058715958 9:107722190-107722212 AGGAAGGGGAGTGAAGAGGAGGG - Intergenic
1058985871 9:110207912-110207934 AAGAAAGAGAGGGAGGAAGATGG + Exonic
1059393740 9:114017533-114017555 ATGAAAGAGAGGGAGGCTGATGG - Intronic
1059460376 9:114425868-114425890 ATGAAAGAGAGGGAGGGAGAGGG - Intronic
1059665977 9:116447058-116447080 GTGAAGCAGAGTGGGGAGGAAGG - Intronic
1059678842 9:116566856-116566878 GTGAAGGAGAGTGGGAAGGAAGG - Intronic
1059965516 9:119609850-119609872 AAGAAAGAGAGAGAGAAGGAGGG - Intergenic
1060005019 9:119992192-119992214 CTGACTGGGAGGGAGGAGGAGGG - Intergenic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1060851801 9:126883360-126883382 ATGAGAGACAGTGAGGAGGGAGG + Exonic
1061281929 9:129602520-129602542 AGGAAGGACAGGGAGGAGGAGGG + Intergenic
1061434893 9:130554882-130554904 ATCAGTGAGAGGGAGGAGGTGGG + Intergenic
1061633884 9:131893141-131893163 TTTAATGAGAGTCATGAGGAAGG + Intronic
1061885736 9:133590242-133590264 AGGAAGGAGAGAGAGAAGGAAGG - Intergenic
1062220046 9:135410161-135410183 GAGAGTGAGAGTGAGGGGGAAGG - Intergenic
1062437205 9:136551563-136551585 AGGAAGGAGAGGGAGGGGGAGGG - Intergenic
1062685836 9:137812795-137812817 GTGAATGTGGGAGAGGAGGAAGG + Intronic
1202797761 9_KI270719v1_random:141305-141327 AGGAAGGAGAGAGAGAAGGAAGG + Intergenic
1202802091 9_KI270720v1_random:9488-9510 AGGAAGGAGAGAGAGAAGGAGGG - Intergenic
1203428172 Un_GL000195v1:61133-61155 ATGAATAGGAGTGGGGAGAAAGG - Intergenic
1185492821 X:531936-531958 ATAAATGACAGTGGGGAAGATGG + Intergenic
1185824896 X:3240631-3240653 AGGAAGGAGAGTGAGAGGGAGGG - Intergenic
1186193549 X:7089323-7089345 ATAAAAGAGAGTGAGGTGAAGGG + Intronic
1186303421 X:8227137-8227159 ATGAAGGAGAGGAGGGAGGAAGG - Intergenic
1186303422 X:8227141-8227163 ATGAATGAAGGAGAGGAGGGAGG - Intergenic
1186712538 X:12215280-12215302 CAGAGTGAGAGAGAGGAGGAGGG - Intronic
1187128877 X:16481689-16481711 ATGAAGGAGAGAGAGAGGGAGGG - Intergenic
1187461878 X:19494298-19494320 AAGAGAGAGAGAGAGGAGGAGGG + Intronic
1187535289 X:20136173-20136195 ATGAATGAGATTGGGGGTGAGGG - Intronic
1187580041 X:20597533-20597555 ATGCATGAGTGTGTGGAGGGAGG - Intergenic
1187966310 X:24615708-24615730 ATGAATGAAAGTTTGGAGGCAGG - Intronic
1188360759 X:29250340-29250362 ATGAACTTGAGTGAGTAGGATGG + Intronic
1188819274 X:34753859-34753881 ATTTATGAAAGTGTGGAGGAAGG + Intergenic
1189656901 X:43254145-43254167 ATGTAAGAGACTGAGGAAGAAGG + Intergenic
1189668116 X:43379114-43379136 AAGAATGAGAGGGAGGAGAGGGG + Intergenic
1190116063 X:47626957-47626979 AGGAAAGGGAGTGAGGAGAAAGG + Intronic
1190239241 X:48644529-48644551 AAGCAGGAGAGTGAGAAGGAAGG - Intergenic
1190463138 X:50698823-50698845 ATGAATGAGAGGAAGGGTGAAGG + Intronic
1190627612 X:52351993-52352015 AAGAAAGAAAGAGAGGAGGAAGG - Intergenic
1191936695 X:66434633-66434655 ATGACTGAGAAGGTGGAGGAGGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193714805 X:84925952-84925974 ATCATTGAGATTCAGGAGGATGG - Intergenic
1193859058 X:86641153-86641175 ATCATTGAGATTTAGGAGGATGG + Intronic
1194217392 X:91147933-91147955 GTGAACCAGAGTGAAGAGGATGG + Intergenic
1194593796 X:95834469-95834491 ATTATTGAGATTCAGGAGGATGG - Intergenic
1194664737 X:96664987-96665009 ATGTATGAGAGTGTGGCCGATGG + Intergenic
1194768701 X:97873928-97873950 ATGAAAGCAGGTGAGGAGGAAGG - Intergenic
1195586473 X:106570652-106570674 ATGAAAGAAATTGAGGAGGAGGG + Intergenic
1196124221 X:112082344-112082366 GTGAAGGAGAGGGAGAAGGAGGG + Exonic
1196353874 X:114764996-114765018 AAGAAAGAGAGAGAGAAGGACGG - Intronic
1196404861 X:115350485-115350507 ATGAGAAAGAGAGAGGAGGAAGG + Intergenic
1197749659 X:129955866-129955888 AAGAAAGAAAGAGAGGAGGAAGG + Intergenic
1197851792 X:130869983-130870005 ATGAAAGAGAGAGAGGAAGAAGG + Intronic
1198127609 X:133661667-133661689 ATAACCGAGAGAGAGGAGGAGGG - Intronic
1198210921 X:134515388-134515410 AAGAAAGAGAGAGAGAAGGAAGG + Intronic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198440691 X:136660217-136660239 ATAGATGAGGGTGAGGAGTAGGG + Exonic
1198820827 X:140646399-140646421 CTGAATGGGAGGGAGGGGGAGGG + Intergenic
1199005271 X:142688588-142688610 AAGAAAGGGAGGGAGGAGGAAGG - Intergenic
1199249149 X:145639104-145639126 ATTATTGAGATTCAGGAGGATGG + Intergenic
1199871278 X:151901054-151901076 ATGAGTCTGAGAGAGGAGGATGG + Intergenic
1199871419 X:151902015-151902037 ATGAGTCTGAGAGAGGAGGATGG + Intergenic
1200007910 X:153100004-153100026 AAGACTGAGTGTGAGGAGGGGGG + Intergenic
1200019371 X:153188972-153188994 ATGAGGAAGAGTGTGGAGGACGG + Intergenic
1200183636 X:154167426-154167448 ATGTATGAGAGAGAGGCAGAAGG + Intergenic
1200189290 X:154204554-154204576 ATGTATGAGAGAGAGGCAGAAGG + Intergenic
1200195045 X:154242363-154242385 ATGTATGAGAGAGAGGCAGAAGG + Intergenic
1200200695 X:154279484-154279506 ATGTATGAGAGAGAGGCAGAAGG + Intronic
1200553906 Y:4611725-4611747 GTGAACCAGAGTGAAGAGGATGG + Intergenic
1201300187 Y:12498531-12498553 AGGGAAGAGAGGGAGGAGGAAGG - Intergenic
1201636458 Y:16128217-16128239 AGGAAAGAGAGTGAGGAGAGAGG - Intergenic
1202025561 Y:20519068-20519090 CAGAATGGGAGTGAGAAGGAAGG + Intergenic
1202056567 Y:20839329-20839351 ATGAATAAGAGTGATGAACATGG + Intergenic
1202083703 Y:21112571-21112593 TTGAAAGAGAGTGAGGAGAGAGG + Intergenic