ID: 1039258692

View in Genome Browser
Species Human (GRCh38)
Location 8:35747008-35747030
Sequence ACCTTTAAGTAGGGGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039258692_1039258697 21 Left 1039258692 8:35747008-35747030 CCTTGCCTCCCCTACTTAAAGGT 0: 1
1: 0
2: 0
3: 19
4: 139
Right 1039258697 8:35747052-35747074 AACCTGTGTTTTGCTCGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039258692 Original CRISPR ACCTTTAAGTAGGGGAGGCA AGG (reversed) Intronic
905004508 1:34698878-34698900 ACCTGGGTGTAGGGGAGGCAGGG + Intergenic
905682998 1:39887970-39887992 GGCTTTCAGTAGGGCAGGCAAGG - Intergenic
908109439 1:60880479-60880501 ACAATTAAGTAAGGGTGGCAGGG + Intronic
911772466 1:101764199-101764221 ACCATTTAGTAGGTGAGGCTTGG - Intergenic
912665881 1:111579159-111579181 ACCTCCAAGGAGGGGAGGGAGGG - Intronic
913437134 1:118858854-118858876 ACCATTAAACAGTGGAGGCAGGG - Intergenic
914693131 1:150049126-150049148 ACCTCTAAGTAGACGGGGCATGG - Intergenic
1064325198 10:14343859-14343881 ACATTTAAATAAGGGAGTCAGGG - Intronic
1065141906 10:22726143-22726165 GCCTTTTAGAAGGGGAGGTAGGG - Intergenic
1067531421 10:47076788-47076810 ACCTTTAAGTATAGGATGGAAGG + Intergenic
1069620865 10:69836504-69836526 ACATATAAGCAGGGGAGGGAGGG + Intronic
1070072966 10:73107492-73107514 AAAATTAAGTAGGGGAGGCGCGG - Intergenic
1073177661 10:101566268-101566290 AGCTGTATGTAGGGGGGGCAGGG - Intergenic
1077363686 11:2152657-2152679 ACCTGTGGGTAGGGGAGGCAGGG - Intronic
1079092115 11:17488372-17488394 ACCTCTCAGGAGAGGAGGCAGGG + Intergenic
1080549655 11:33361459-33361481 ACCCTTAAGTAATGGAGACATGG - Intergenic
1080859789 11:36143255-36143277 ACTTTTAAGCAGGGGAAGCAAGG - Intronic
1086940026 11:92786670-92786692 ACCTTTGAGTAGGGGAAATATGG + Intronic
1090462549 11:126905174-126905196 GCCTTCAAGTAGGGAAGCCATGG - Intronic
1090590196 11:128259165-128259187 ACCTTTAAATAGGGGAGGGTGGG - Intergenic
1092713403 12:11362782-11362804 ACCTTTAAGCATGGAAGGAATGG + Intronic
1092717114 12:11401989-11402011 ACCTTTAAGCATGGAAGGAATGG + Intronic
1093362462 12:18247606-18247628 ACGTTTACATAGGGCAGGCAAGG + Intronic
1095196020 12:39318657-39318679 ATCTTTAAGTACAGGAAGCAAGG + Intronic
1096155651 12:49339971-49339993 ACCTTTAAGTGGGGGAGCCTAGG - Intergenic
1102934165 12:116882754-116882776 ACCTTTAGGCAGCAGAGGCAAGG - Intergenic
1106257946 13:28038746-28038768 AACTTTAAGTAGGCTAGGCTGGG - Intronic
1106593946 13:31121301-31121323 TGCTTTAAGCAGGGGAAGCAGGG + Intergenic
1111061085 13:83019745-83019767 ACACTTAAGTAGGAGAGGGAAGG + Intergenic
1114544762 14:23490947-23490969 ACCTTTATGGAGGGGAGACAAGG - Intronic
1120221122 14:81734925-81734947 ACCTTGTTGTAGGGGAGGAAAGG - Intergenic
1120617604 14:86727185-86727207 ATTTTTAAGTAGGGTGGGCAGGG - Intergenic
1122044268 14:99012176-99012198 CCCTTGAAGGATGGGAGGCAGGG - Intergenic
1122125092 14:99574570-99574592 GCCTGTGAGGAGGGGAGGCAGGG + Intronic
1126316703 15:47377642-47377664 ATTTTGAAGTAAGGGAGGCAAGG + Intronic
1126900899 15:53313483-53313505 ACCTTTAATAAGGGGATGAAAGG + Intergenic
1136688199 16:32008517-32008539 GCCTTTAAGAAACGGAGGCATGG + Intergenic
1141726573 16:85793241-85793263 ACCGTAAAGAAGGCGAGGCAGGG + Intronic
1142549612 17:730512-730534 CCCTTTAAGGAGGGAAGGCAGGG + Intergenic
1147882692 17:43664320-43664342 TCCTTTATGTAGGCCAGGCACGG + Intergenic
1148531003 17:48391641-48391663 TCCTTTAAGGATGGGAGGGAGGG + Intronic
1149088104 17:52744123-52744145 ACCTTGAAGCAGGGGAGTCAAGG + Intergenic
1153066030 18:1046061-1046083 ACTTTTAAGGTGGGTAGGCAAGG + Intergenic
1156167234 18:34436901-34436923 ACATTTAAGTAGGCTGGGCATGG - Intergenic
1156326672 18:36079776-36079798 ACCATCAAGTGGGGGGGGCAAGG - Intergenic
1158524256 18:58198037-58198059 TCCTTTATGTAGGGGTGCCAAGG - Intronic
1158775602 18:60575025-60575047 AGCTTTCAGCAGGAGAGGCATGG + Intergenic
1160098495 18:75898460-75898482 ACCTTTTAGCTGAGGAGGCAGGG - Intergenic
1161308348 19:3579283-3579305 AACTTTAGGTAGGGGAGGGATGG - Intergenic
1161751282 19:6098787-6098809 ATCTTTAAGAAAGGGAGCCAAGG + Intronic
1162916426 19:13876874-13876896 TCCTACAAGGAGGGGAGGCAGGG + Intronic
1162937243 19:13987334-13987356 ACCTTTAGGCAGGGCAGGCAGGG + Intronic
1165865488 19:38934568-38934590 GCCAGTAAGTAGGGGAGGCAGGG - Intronic
1167024940 19:46908889-46908911 ACCTTTAAGCAGGGATTGCATGG + Intergenic
1168533620 19:57150487-57150509 AACTTGAAGTAGGCCAGGCATGG - Intergenic
929011511 2:37449848-37449870 AGCTCCAAGAAGGGGAGGCAGGG - Intergenic
932561860 2:72879808-72879830 GACTTTAAGTAGGCCAGGCATGG - Intergenic
933732517 2:85468157-85468179 GGCTTTAAGGAGGGGAGGAAGGG + Intergenic
936817022 2:116472321-116472343 ACATTTAATTAGGCCAGGCACGG + Intergenic
937463279 2:122108048-122108070 AGCTTTAAGCTGGGGAGGAAGGG + Intergenic
938321743 2:130370837-130370859 ACCATCAAGAAGGGAAGGCAGGG - Intronic
940366175 2:152851473-152851495 ACCTCTAAATGGGGGTGGCATGG + Intergenic
940505738 2:154550606-154550628 TACTTTAAGTAGGGTAGTCATGG - Intergenic
942874101 2:180772214-180772236 AACTCTAAGTAGGGCAGGCGCGG + Intergenic
944908499 2:204286302-204286324 ACCTTTGATTAGTGGAGGCTGGG + Intergenic
947993290 2:234504445-234504467 ACCTTTAAGGAGAGGAGTTATGG - Intergenic
1168951509 20:1805110-1805132 ACCTTTGAGTAGGAGAAGCAGGG + Intergenic
1169936993 20:10894147-10894169 CACTCCAAGTAGGGGAGGCAGGG + Intergenic
1169945809 20:10986639-10986661 AGCTTGAAGTAGGAGAGGCGAGG + Intergenic
1172119771 20:32591242-32591264 ACTTTTAAGAAGGGCAGTCAAGG - Intronic
1172713657 20:36947116-36947138 AGCTTTGAGTTGGGGAGGGAAGG + Intronic
1174224289 20:48984413-48984435 TCCTTTATTTAAGGGAGGCAGGG + Intronic
1174805001 20:53597629-53597651 ACCTTTCAGAAGAGAAGGCAGGG + Intronic
1175157411 20:56980774-56980796 TCCTTTAAATAGGAGGGGCAGGG + Intergenic
1175464373 20:59179880-59179902 AGCTTTATGTAAGGGAAGCATGG - Intergenic
1178885661 21:36483055-36483077 ACCTGTAAGTGGTGGAGGCAGGG + Intronic
1180213627 21:46311474-46311496 ACCGTTGAGTAGGGAAGGCCTGG + Exonic
1183361123 22:37384073-37384095 CCCTGTGAGCAGGGGAGGCACGG - Intronic
1183717672 22:39543363-39543385 AGCTTTGGGTCGGGGAGGCAGGG - Intergenic
949487660 3:4555215-4555237 ACCTTAAAGCAGGAGAGGCAGGG - Intronic
949862749 3:8521453-8521475 GCCTTTGAGAAGGGGAAGCATGG - Intronic
950143747 3:10633286-10633308 ACCTTTTGGAAGCGGAGGCAGGG - Intronic
951550431 3:23871314-23871336 ACTTCTCAGTAGGGGCGGCAGGG + Intronic
951550479 3:23871443-23871465 ACTTCTCAGTAGGGGCGGCAGGG + Intronic
951921811 3:27862946-27862968 ACCCTCTAGTAGGGAAGGCATGG + Intergenic
955942658 3:64161080-64161102 ACTTTTAAGTAGGAGCGTCAGGG - Intronic
956523609 3:70132433-70132455 ACATTTGTGAAGGGGAGGCATGG - Intergenic
958157977 3:89779601-89779623 AAATGTAAGTAGGGGATGCATGG - Intergenic
958667836 3:97162710-97162732 ACCTTAAATGAGGGGAGGCTGGG - Intronic
961950142 3:130741090-130741112 AACTTGCAGGAGGGGAGGCAGGG - Intronic
963542554 3:146611636-146611658 ACCTTTCATTCAGGGAGGCAAGG - Intergenic
964188674 3:153977648-153977670 ACCTTTATGATGGGGAGGAATGG - Intergenic
965813428 3:172614358-172614380 ACCTTTAAGCCGGGGAGGGCTGG - Intergenic
965820862 3:172683101-172683123 TGCTTTAAGAAGCGGAGGCAGGG + Intronic
969064867 4:4470771-4470793 ACCTTTAAGGAAGGCTGGCATGG + Intronic
969106769 4:4812211-4812233 ACTTTTTATTATGGGAGGCAGGG + Intergenic
972690234 4:41389958-41389980 AGCTTTAAGTAGGAGAAGAAAGG - Intronic
972810844 4:42584233-42584255 ACCATAAAGTAGGGGAAGCAGGG + Intronic
977445576 4:97127511-97127533 ACCTTTATTTATGGGACGCAAGG + Intergenic
977880467 4:102198533-102198555 ACATTTTAGTAGTGGAGACAGGG - Intergenic
984207040 4:176797805-176797827 ACCTTTAGTTTGGGGAGCCAAGG + Intergenic
989281162 5:39645109-39645131 ACCCTTAAGATGGGGAGGAAAGG + Intergenic
989702720 5:44289577-44289599 ACCTTTTCGGAGGGGAAGCAAGG - Intergenic
992896114 5:81246413-81246435 ACTTTTAAATAGGCTAGGCAGGG - Intronic
993201163 5:84817020-84817042 ATCTTTAAGTAGAGGAACCAGGG + Intergenic
993869863 5:93239886-93239908 GCCTTGAAGTATGGGTGGCATGG - Intergenic
997386256 5:133475102-133475124 GCATTTAAGTATGGGAAGCAGGG + Intronic
997879400 5:137576024-137576046 TCCCTTAAGTGGGAGAGGCAAGG + Intronic
999104183 5:149054890-149054912 ACCTTGAAGAAGGGAAGTCAAGG + Intronic
999299402 5:150481844-150481866 ACCTATAAGGAGGCGAGGCCCGG - Intergenic
1004084460 6:12431334-12431356 ACTTTTAAGATGGGAAGGCAGGG - Intergenic
1004999379 6:21225255-21225277 AGCAGTAAGTAGAGGAGGCAGGG + Intronic
1006184156 6:32170881-32170903 AGGTTTCAGGAGGGGAGGCATGG + Exonic
1006192954 6:32220683-32220705 CCCTATGAGTAGGGGAGGCCAGG + Intronic
1006830432 6:36964757-36964779 TTCTTTGAGTGGGGGAGGCAGGG + Exonic
1007302030 6:40874858-40874880 AGCCTTAAGGAGGGGTGGCAGGG - Intergenic
1013588580 6:111601194-111601216 ACCTTGAAGCTGAGGAGGCATGG + Intronic
1014943274 6:127468381-127468403 ACCTTTAAGCAGGGAAGACATGG + Intronic
1017086172 6:150715087-150715109 ACCTGTCAGTAGGCCAGGCATGG - Intronic
1017397252 6:154016497-154016519 ACCTTTAAGTGAGGGAAGAAGGG + Intronic
1020548393 7:9565417-9565439 ACCTTTCAGTGGGGAAGGGAAGG + Intergenic
1024340240 7:48250353-48250375 ACCTCTAGGTAGGGGAGAGAGGG - Intronic
1024781437 7:52855308-52855330 CCCTTTAAGTAGATGATGCATGG - Intergenic
1028951091 7:96635701-96635723 ACCTTTTAGAATGAGAGGCAAGG + Intronic
1029978851 7:104859376-104859398 AGCATTAAGTAGGCCAGGCATGG + Intronic
1033203426 7:139394501-139394523 ACTTTAAAGAAGTGGAGGCAGGG + Intronic
1033584507 7:142764065-142764087 ACCTTTAAGGGGGGGAGTCGTGG - Intergenic
1034187969 7:149193992-149194014 ACCTTTAAATCGGGCAGTCATGG - Intergenic
1034255029 7:149720226-149720248 AGGTTGCAGTAGGGGAGGCAGGG - Intronic
1036394889 8:8361215-8361237 ACCTCTTAGTAGGGGAGGAAAGG + Intronic
1037309444 8:17538981-17539003 ACCTTTACTTAGGGGAGGAAGGG + Intronic
1037880979 8:22573227-22573249 ACCTTCTAGTGGGGGAGGGAGGG + Intronic
1038803243 8:30768286-30768308 ACCTTAAATTAGGGGTGGGAGGG + Intergenic
1039258692 8:35747008-35747030 ACCTTTAAGTAGGGGAGGCAAGG - Intronic
1039555480 8:38472107-38472129 ACATTTCTGTATGGGAGGCAAGG - Intergenic
1040806455 8:51402227-51402249 TCTTTTAAGGAGCGGAGGCAGGG + Intronic
1043342702 8:79260118-79260140 ACATTTAAGTAGAGAAGGCAGGG - Intergenic
1048880267 8:138866806-138866828 ACCTCTAAAAATGGGAGGCAGGG + Intronic
1050254170 9:3776836-3776858 ACCTGGAAGTAGGAGAGGGAGGG + Intergenic
1050271188 9:3947049-3947071 ACCTCTCAGAATGGGAGGCAGGG + Intronic
1050514592 9:6429947-6429969 AACCTGAAGTATGGGAGGCAAGG - Intronic
1050731216 9:8712108-8712130 ACCAAGAAGTAGGGGAGGGAGGG + Intronic
1055274286 9:74596720-74596742 ACCAATAAGCAGGGGAAGCATGG - Intronic
1058480325 9:105386730-105386752 TCATTTAAGTAGGCTAGGCATGG + Intronic
1059460001 9:114423620-114423642 ACAGTTAAGGAGGGGAGGCAGGG - Intronic
1060077737 9:120608472-120608494 ACATTTAAGTTTGGGAGGGATGG - Intronic
1060773112 9:126347054-126347076 ACCTTTAACAAAGGGAGTCATGG - Intronic
1061840037 9:133353374-133353396 ACCTTGAGGGAGTGGAGGCAGGG - Intronic
1185719345 X:2369941-2369963 ACATTTCAGTAGGGGAGTCCGGG - Intronic
1186133851 X:6497790-6497812 TCCTTAAAGGTGGGGAGGCATGG - Intergenic
1187534959 X:20133069-20133091 CCCTGTAAGTAGGAGGGGCACGG + Intronic
1189484724 X:41421297-41421319 ACCTCCAAGCAGGGCAGGCATGG + Intergenic
1191883483 X:65864951-65864973 ACCTGTAAGCAGGGAAGTCAGGG + Intergenic
1195382328 X:104282626-104282648 AGTTTTAAGTAGCGAAGGCAAGG - Intergenic
1196208326 X:112966845-112966867 ACCTTTATGGTGGGGAGGAAAGG - Intergenic
1197632426 X:128876755-128876777 AGCTATGACTAGGGGAGGCAAGG - Intergenic
1197759758 X:130019731-130019753 ACCTTCTAGCAGGCGAGGCATGG + Intronic
1201772895 Y:17634616-17634638 AACTTTAAGTAGGCTGGGCATGG - Intergenic
1201828660 Y:18271370-18271392 AACTTTAAGTAGGCTGGGCATGG + Intergenic